Skip to Content
Merck
CN

EHU081461

MISSION® esiRNA

targeting human AXL

Sign In to View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGATCAATTATAGTTTCTGAGGCTTTATGATAATAGATTCTCTTGTATAAGATCCTAGATCCTAAGGGTCGAAAGCTCTAGAATCTGCAATTCAAAAGTTCCAAGAGTCTAAAGATGGAGTTTCTAAGGTCCGGTGTTCTAAGATGTGATATTCTAAGACTTACTCTAAGATCTTAGATTCTCTGTGTCTAAGATTCTAGATCAGATGCTCCAAGATTCTAGATGATTAAATAAGATTCTAACGGTCTGTTCTGTTTCAAGGCACTCTAGATTCCATTGGTCCAAGATTCCGGATCCTAAGCATCTAAGTTATAAGACTCTCACACTCAGTTGTGACTAACTAGACACCAAAGTTCTAATAATTTCTAATGTTGGACACCTTTAGGTTCTTTGCTGCATTCTGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... AXL(558), AXL(558)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jian-Zhong Lin et al.
Oncotarget, 8(25), 41064-41077 (2017-04-30)
Resistance to docetaxel is a major clinical problem in advanced prostate cancer. The overexpression of AXL receptor tyrosine kinase (AXL) has been correlated with chemotherapeutic drug resistance. However, the role of AXL expression in docetaxel resistance in prostate cancer is
Wenwen Du et al.
Oncology reports, 44(1), 185-195 (2020-04-23)
Gefitinib is currently the preferred treatment for non‑small cell lung cancer (NSCLC) patients with epidermal growth factor receptor (EGFR)‑activating mutation. However, some patients gradually develop acquired resistance after receiving treatment. In addition to secondary T790M mutation, the remaining mechanisms contributing
Nellie K McDaniel et al.
Molecular cancer therapeutics, 17(11), 2297-2308 (2018-08-11)
The TAM (TYRO3, AXL, MERTK) family receptor tyrosine kinases (RTK) play an important role in promoting growth, survival, and metastatic spread of several tumor types. AXL and MERTK are overexpressed in head and neck squamous cell carcinoma (HNSCC), triple-negative breast
Qiang Zuo et al.
Oncogene, 37(24), 3275-3289 (2018-03-20)
Multiple genetic mutations within melanoma not only cause lesion-specific responses to targeted therapy but also alter the molecular route of resistance to that therapy. Inactivation of PTEN occurs in up to 30% of melanomas, frequently with a concurrent activating BRAF
Jeanne M Quinn et al.
Molecular cancer therapeutics, 18(2), 389-398 (2018-11-28)
Ovarian cancer, one of the deadliest malignancies in female cancer patients, is characterized by recurrence and poor response to cytotoxic chemotherapies. Fewer than 30% of patients with resistant disease will respond to additional chemotherapy treatments. This study aims to determine

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service