Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GTCCTGGATGCTGGTTATGGAGATGGCAGAACTTGGTCCCCTCAATAAGTATTTGCAGCAGAACAGACATGTCAAGGATAAGAACATCATAGAACTGGTTCATCAGGTTTCCATGGGCATGAAGTACTTGGAGGAGAGCAATTTTGTGCACAGAGATCTGGCTGCAAGAAATGTGTTGCTAGTTACCCAACATTACGCCAAGATCAGTGATTTCGGACTTTCCAAAGCACTGCGTGCTGATGAAAACTACTACAAGGCCCAGACCCATGGAAAGTGGCCTGTCAAGTGGTACGCTCCGGAATGCATCAACTACTACAAGTTCTCCAGCAAAAGCGATGTCTGGAGCTTTGGAGTGTTGATGTGGGAAGCATTCTCCTATGGGCAGAAGCCATATCGAGGGATGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... SYK(6850)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Morgan Black et al.
Oral oncology, 101, 104529-104529 (2019-12-23)
Spleen tyrosine kinase (SYK) is a promoter of cell survival in a variety of cell types, including normal and cancerous epithelial cells. We hypothesized that SYK would an important therapeutic target to inhibit for the treatment of HNSCC. SYK protein
George E Duran et al.
PloS one, 14(1), e0210879-e0210879 (2019-01-23)
In a previously published study, higher levels of spleen tyrosine kinase (Syk) were observed in recurrent post-chemotherapy ovarian cancers compared to primary tumors. Syk inhibition was found to stabilize microtubules and potentiate paclitaxel activity in cellular models of taxane-resistant ovarian
Pan Gao et al.
Oncotarget, 8(48), 83900-83912 (2017-11-16)
Spleen tyrosine kinase (SYK), a non-receptor cytoplasmic tyrosine enzyme, is well known for its ability in certain pathways through immune receptors. Recently
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU081641-50UG | 04061831373479 |
| EHU081641-20UG | 04061828632039 |