Skip to Content
Merck
CN

EHU081641

MISSION® esiRNA

targeting human SYK

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human SYK

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTCCTGGATGCTGGTTATGGAGATGGCAGAACTTGGTCCCCTCAATAAGTATTTGCAGCAGAACAGACATGTCAAGGATAAGAACATCATAGAACTGGTTCATCAGGTTTCCATGGGCATGAAGTACTTGGAGGAGAGCAATTTTGTGCACAGAGATCTGGCTGCAAGAAATGTGTTGCTAGTTACCCAACATTACGCCAAGATCAGTGATTTCGGACTTTCCAAAGCACTGCGTGCTGATGAAAACTACTACAAGGCCCAGACCCATGGAAAGTGGCCTGTCAAGTGGTACGCTCCGGAATGCATCAACTACTACAAGTTCTCCAGCAAAAGCGATGTCTGGAGCTTTGGAGTGTTGATGTGGGAAGCATTCTCCTATGGGCAGAAGCCATATCGAGGGATGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... SYK(6850), SYK(6850)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Morgan Black et al.
Oral oncology, 101, 104529-104529 (2019-12-23)
Spleen tyrosine kinase (SYK) is a promoter of cell survival in a variety of cell types, including normal and cancerous epithelial cells. We hypothesized that SYK would an important therapeutic target to inhibit for the treatment of HNSCC. SYK protein
Pan Gao et al.
Oncotarget, 8(48), 83900-83912 (2017-11-16)
Spleen tyrosine kinase (SYK), a non-receptor cytoplasmic tyrosine enzyme, is well known for its ability in certain pathways through immune receptors. Recently
George E Duran et al.
PloS one, 14(1), e0210879-e0210879 (2019-01-23)
In a previously published study, higher levels of spleen tyrosine kinase (Syk) were observed in recurrent post-chemotherapy ovarian cancers compared to primary tumors. Syk inhibition was found to stabilize microtubules and potentiate paclitaxel activity in cellular models of taxane-resistant ovarian

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service