Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGCCTGCCTCTTCCTTTCTACGCTGCTCCTTGTGCTCAACAAATGTGGACGGAGAAACAAGTTTGGGATCAACCGCCCGGCTGTGCTGGCTCCAGAGGATGGGCTGGCCATGTCCCTGCATTTCATGACATTGGGTGGCAGCTCCCTGTCCCCCACCGAGGGCAAAGGCTCTGGGCTCCAAGGCCACATCATCGAGAACCCACAATACTTCAGTGATGCCTGTGTTCACCACATCAAGCGCCGGGACATCGTGCTCAAGTGGGAGCTGGGGGAGGGCGCCTTTGGGAAGGTCTTCCTTGCTGAGTGCCACAACCTCCTGCCTGAGCAGGACAAGATGCTGGTGGCTGTCAAGGCACTGAAGGAGGCGTCCGAGAGTGCTCGGCAGGACTTCCAGCGTGAGGCTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... NTRK1(4914)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Marzia Di Donato et al.
Cancers, 11(6) (2019-06-09)
Resistance to hormone therapy and disease progression is the major challenge in clinical management of prostate cancer (PC). Drugs currently used in PC therapy initially show a potent antitumor effects, but PC gradually develops resistance, relapses and spreads. Most patients
Wenyu Shi et al.
Molecular oncology, 11(9), 1189-1207 (2017-05-31)
Nucleophosmin-anaplastic lymphoma kinase-expressing (NPM-ALK+ ) T-cell lymphoma is an aggressive neoplasm that is more commonly seen in children and young adults. The pathogenesis of NPM-ALK+ T-cell lymphoma is not completely understood. Wild-type ALK is a receptor tyrosine kinase that is
Sam Faulkner et al.
The American journal of pathology, 188(1), 229-241 (2017-10-19)
Neurotrophin receptors are emerging targets in oncology, but their clinicopathologic significance in thyroid cancer is unclear. In this study, the neurotrophin tyrosine receptor kinase TrkA (also called NTRK1), the common neurotrophin receptor p75NTR, and the proneurotrophin receptor sortilin were analyzed
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU081661-50UG | 04061828404872 |
| EHU081661-20UG | 04061828632053 |