Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GTGACTGCCACGGTGAATAATTCAGTTCTTCAGAAGCAGCAACATGATCTCATGGAGACAGTTAATAACTTACTGACTATGATGTCCACATCAAACTCAGCTAAGGACCCCACTGTTGCTAAAGAAGAACAAATCAGCTTCAGAGACTGTGCTGAAGTATTCAAATCAGGACACACCACGAATGGCATCTACACGTTAACATTCCCTAATTCTACAGAAGAGATCAAGGCCTACTGTGACATGGAAGCTGGAGGAGGCGGGTGGACAATTATTCAGCGACGTGAGGATGGCAGCGTTGATTTTCAGAGGACTTGGAAAGAATATAAAGTGGGATTTGGTAACCCTTCAGGAGAATATTGGCTGGGAAATGAGTTTGTTTCGCAACTGACTAATCAGCAACGCTATGTGCTTAAAATACACCTTAAAGACTGGGAAGGG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... ANGPT2(285)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Mi-Lan Kang et al.
Journal of cellular biochemistry, 118(9), 2896-2908 (2017-02-19)
Our previous studies revealed that co-transplantation of bone marrow stem cells (BMSCs) and adipose-derived stem cells (ADSCs) can enhance bone regeneration and angiogenesis. However, it is unclear which genes are involved in the regulation of osteogenesis and/or angiogenesis during the
Shivam Chandel et al.
Atherosclerosis, 307, 1-10 (2020-07-18)
Angiopoietin-2 (ANG-2) mediates endothelial inflammation to initiate atherosclerosis and angiogenesis. Here we determined the serum levels of ANG-2 in hyperinsulinemic subjects and whether insulin increases its expression and release. Healthy male subjects were recruited from the D-CLIP and CURES studies
Pragnya Das et al.
Frontiers in physiology, 11, 266-266 (2020-04-25)
Invasive mechanical ventilation (IMV) has become one of the mainstays of therapy in NICUs worldwide, as a result of which premature babies with extremely low birth weight have been able to survive. Although lifesaving, IMV can result in lung inflammation
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU081851-20UG | 04061831354072 |
| EHU081851-50UG | 04061831373486 |