Skip to Content
Merck
CN

EHU082281

MISSION® esiRNA

targeting human TEK

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACTCCCTCCTCCAAGAGGTCTAAATCTCCTGCCTAAAAGTCAGACCACTCTAAATTTGACCTGGCAACCAATATTTCCAAGCTCGGAAGATGACTTTTATGTTGAAGTGGAGAGAAGGTCTGTGCAAAAAAGTGATCAGCAGAATATTAAAGTTCCAGGCAACTTGACTTCGGTGCTACTTAACAACTTACATCCCAGGGAGCAGTACGTGGTCCGAGCTAGAGTCAACACCAAGGCCCAGGGGGAATGGAGTGAAGATCTCACTGCTTGGACCCTTAGTGACATTCTTCCTCCTCAACCAGAAAACATCAAGATTTCCAACATTACACACTCCTCAGCTGTGATTTCTTGGACAATATTGGATGGCTATTCTATTTCTTCTATTACTATCCGTTACAAGGTTCAAGGCAAGAATGAAGACCAGCACGTTGATGTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Adam C Mirando et al.
JCI insight, 4(4) (2019-01-23)
The angiopoietin (Ang)/Tie2 signaling pathway is essential for maintaining vascular homeostasis, and its dysregulation is associated with several diseases. Interactions between Tie2 and α5β1 integrin have emerged as part of this control; however, the mechanism is incompletely understood. AXT107, a
Martin Teichert et al.
Nature communications, 8, 16106-16106 (2017-07-19)
The Tie receptors with their Angiopoietin ligands act as regulators of angiogenesis and vessel maturation. Tie2 exerts its functions through its supposed endothelial-specific expression. Yet, Tie2 is also expressed at lower levels by pericytes and it has not been unravelled
Kaihong Zeng et al.
Molecular and cellular biochemistry, 396(1-2), 239-248 (2014-07-26)
Previously, we confirmed that taurine prevented diabetes-induced apoptosis in retinal glial cells via its anti-oxidation and anti-glutamate excitotoxicity mechanisms. The aim of this study is to investigate the effects of taurine on angiopoietin-2 (Ang-2)/Tie-2 system expressions and apoptosis in high

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service