Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CTGGGACTTTGAGTGCCTTTGCCAGTTATTTCAACAGCAAGGTTGGCATTCCTCAGGAGAATGCAGACCATGATGACTTTGATGCTAATCAACTATTGAACAAGATCAATGAACCACCAAAGCCAGCTCCCAGACAAGTTTCCCTGCCAGTTACCAAATCTACTGACAATGCATTTGAGAACCCTTTCTTTAAAGATTCTTTTGGTTCATCACAAGCCTCTGTGGCTTCTTCTCAACCTGTATCTTCTGAGATGTATAGGGATCCATTTGGAAATCCTTTTGCCTAAATTCTGAACTTGGTCTGCAGACCATCCAGAGGAATAAAAAGGTTGGCCTTAGTAGTCAAAAACAAAGCTGATAGCCAGACACGTTCTGATTTCTGCCCTTGTTCCAGCTTTGACGT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... DAB2(112267931), DAB2(1601)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Yuan Cheng et al.
Journal of experimental & clinical cancer research : CR, 35, 11-11 (2016-01-16)
MicroRNA-106b (miR-106b) was recently identified as an oncogene participating in cancer progression. Transforming growth factor β1(TGF-β1) is an indispensable cytokine regulating the local microenvironment, thereby promoting cervical cancer progression. However, the roles of miR-106b in cervical carcinoma progression and TGF-β1-involvement
Yoshitaka Itami et al.
Diagnostics (Basel, Switzerland), 10(1) (2020-01-24)
Disabled homolog-2 (DAB2) has been reported to be a tumor suppressor gene. However, a number of contrary studies suggested that DAB2 promotes tumor invasion in urothelial carcinoma of the bladder (UCB). Here, we investigated the clinical role and biological function
Mio Nakanishi et al.
Cell, 177(4), 910-924 (2019-04-16)
The assembly of organized colonies is the earliest manifestation in the derivation or induction of pluripotency in vitro. However, the necessity and origin of this assemblance is unknown. Here, we identify human pluripotent founder cells (hPFCs) that initiate, as well as
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU082441-50UG | 04061828394234 |
| EHU082441-20UG | 04061831354195 |