Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GAGCACGCTTACCCTTTCACCTTTGAGATCCCTCCAAACCTTCCATGTTCTGTGACACTGCAGCCGGGGCCCGAAGACACGGGGAAGGCTTGCGGTGTGGACTATGAAGTCAAAGCCTTCTGCGCGGAGAATTTGGAGGAGAAGATCCACAAGCGGAATTCTGTGCGTCTGGTCATCCGGAAGGTTCAGTATGCCCCAGAGAGGCCTGGCCCCCAGCCCACAGCCGAGACCACCAGGCAGTTCCTCATGTCGGACAAGCCCTTGCACCTAGAAGCCTCTCTGGATAAGGAGATCTATTACCATGGAGAACCCATCAGCGTCAACGTCCACGTCACCAACAACACCAACAAGACGGTGAAGAAGATCAAGATCTCAGTGCGCCAGTATGCAGACATCTGCCTTTTCAACACAGCTCAGTACAAGTGCCCTGTTGCC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... ARRB1(408)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Susanne Neumann et al.
The Journal of pharmacology and experimental therapeutics, 364(1), 38-45 (2017-11-02)
Recently, we showed that TSH-enhanced differentiation of a human preosteoblast-like cell model involved a β-arrestin 1 (β-Arr 1)-mediated pathway. To study this pathway in more detail, we sought to discover a small molecule ligand that was functionally selective toward human
Rui Yamaguchi et al.
The American journal of the medical sciences, 357(6), 492-506 (2019-03-27)
Plasminogen activator inhibitor type 1 promotes formation of endothelial microparticles with procoagulant activity. However, it remains unclear whether di-(2-ethylhexyl) phthalate, a peroxisome proliferator-activated receptor α agonist, influences microparticle formation. The effect of di-(2-ethylhexyl) phthalate on release of tissue factor-bearing microparticles
Vincent Zecchini et al.
The EMBO journal, 33(12), 1365-1382 (2014-05-20)
Tumour cells sustain their high proliferation rate through metabolic reprogramming, whereby cellular metabolism shifts from oxidative phosphorylation to aerobic glycolysis, even under normal oxygen levels. Hypoxia-inducible factor 1A (HIF1A) is a major regulator of this process, but its activation under
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU084091-20UG | 04061831354485 |
| EHU084091-50UG | 04061831373608 |