Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCTGAGGAACACCTGAAAGGTGACTTTTACGAAAGTGAACATGGTATAAATATAGACCTTAATATAAATAATCATTTAATTGCTAAAGAGATGGAACATAATACAGTGTGTGCTGCTGGTACTAGTCCTGTTGGGGAAATTGGTGAAGAGAAAATTTTGCCCACCAGTGAGACTAAACAGCGCACAGTATTGGATACCTACCCTGGTGTTAGTGAAGCTGATGCAGGAGAAACTCTATCTTCTACTGGTCCTTTTGCTCTGGAACCTGATGCAACAGGAACTAGTAAGGGTATTGAATTTACCACAGCATCTACTCTCAGTTTAGTTAATAAATATGATGTTGATTTATCTTTAACTACTCAAGATACTGAACATGACATGGTAATTTCCACCAGTCCTAGTGGTGGTAGTGAAGCTGACATTGAAGGGCCTTTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... SON(6651)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Vishnu Priya Battini et al.
International journal of molecular sciences, 16(3), 5886-5899 (2015-03-18)
Pre-mRNA splicing requires proper splice site selection mediated by many factors including snRNPs and serine-arginine rich (SR) splicing factors. Our lab previously reported that the SR-like protein SON maintains organization of pre-mRNA splicing factors in nuclear speckles as well as
Hyehyeon Lee et al.
Molecules and cells, 42(1), 67-78 (2018-12-07)
Methylation of HBV cccDNA has been detected in vivo and in vitro; however, the mechanism and its effects on HBV replication remain unclear. HBx derived from a 1.2-mer HBV replicon upregulated protein levels and enzyme activities of DNA methyltransferase 1
İbrahim Avşar Ilik et al.
eLife, 9 (2020-10-24)
Nuclear speckles (NS) are among the most prominent biomolecular condensates. Despite their prevalence, research on the function of NS is virtually restricted to colocalization analyses, since an organizing core, without which NS cannot form, remains unidentified. The monoclonal antibody SC35
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU084371-20UG | 04061828620173 |
| EHU084371-50UG | 04061828396078 |