Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGAGACCTTCCAAGGACAGCCGTGTTGGTTGGACTCTGAATTTTGAATTGTTATTCTATTTTTTATTTTCCAGAACTCATTTTTTACCTTCAGGGGTGGGAGCTAAGTCAGTTGCAGCTGTAATCAATTGTGCGCAGTTGGGAAAGGAAAGCCAGGACTTGTGGGGTGGGTGGGACCAGAAATTCTTGAGCAAATTTTCAGGAGAGGGAGAAGGGCCTTCTCAGAAGCTTGAAGGCTCTGGCTTAACAGAGAAAGAGACTAATGTGTCCAATCATTTTTAAAAATCATCCATGAAAAAGTGTCTTGAGTTGTGGACCCATTAGCAAGTGACATTGTCACATCAGAACTCATGAAACTGATGTAAGGCAATTAATTTGCTTCTGTTTTTAGGTCTGGGAGGGC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... ETS1(2113)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Haihong Liao et al.
Oncology reports, 40(4), 2389-2398 (2018-08-15)
An increasing number of studies have reported that microRNAs (miRNAs) are dysregulated in cervical cancer and serve critical roles in cervical oncogenesis and progression. Therefore, identifying the aberrantly expressed miRNAs implicated in the formation and progression of cervical cancer may
Manhui Zhu et al.
Cell and tissue research, 376(3), 341-351 (2019-03-06)
Choroidal neovascularization (CNV) is the basic feature of neovascular age-related macular degeneration (AMD), the leading cause of blindness in elders. Macrophages and microglia promote CNV via producing pro-angiogenic factors and inflammatory cytokines. Transcription factor E26 transformation specific-1 (Ets1) plays a
Chrisostomos Chrisostomidis et al.
International journal of dermatology, 54(9), 989-995 (2015-07-16)
The aim of this study was to investigate if the expression of CD105 and Ets-1 was predictive of aggressive biologic behavior of non-melanoma skin cancers (NMSC) and to evaluate indicators of local recurrence. A total of 144 patients with NMSC
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU084801-50UG | 04061831373639 |
| EHU084801-20UG | 04061831354607 |