Skip to Content
Merck
CN

EHU085401

Sigma-Aldrich

MISSION® esiRNA

targeting human GATA4

Sign Into View Organizational & Contract Pricing

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCTCCTTCAGGCAGTGAGAGCCTTCCTCCCGCCAGCGGTGCTTCCAGCAACTCCAGCAACGCCACCACCAGCAGCAGCGAGGAGATGCGTCCCATCAAGACGGAGCCTGGCCTGTCATCTCACTACGGGCACAGCAGCTCCGTGTCCCAGACGTTCTCAGTCAGTGCGATGTCTGGCCATGGGCCCTCCATCCACCCTGTCCTCTCGGCCCTGAAGCTCTCCCCACAAGGCTATGCGTCTCCCGTCAGCCAGTCTCCACAGACCAGCTCCAAGCAGGACTCTTGGAACAGCCTGGTCTTGGCCGACAGTCACGGGGACATAATCACTGCGTAATCTTCCCTCTTCCCTCCTCAAATTCCTGCACGGACCTGGGACTTGGAGGATAGCAAAGAAGGAGGCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yihua Pei et al.
Oncotarget, 7(47), 77890-77901 (2016-10-28)
GATA4 is a zinc finger DNA-binding protein that plays an important role in mammalian liver development. However, the effects of GATA4 in hepatoblastoma (HB), a common liver cancer in pediatric patients, remain largely unknown. In this study, we demonstrate that
Caterina Negroni et al.
EBioMedicine, 59, 102941-102941 (2020-08-19)
Meningiomas are the most common primary intracranial tumours. They are classified as grade I, II, and III based on their histopathological features. While most meningiomas can be managed by surgery alone, adjuvant treatment may be required in case of recurrent
Li Jin et al.
Scientific reports, 7(1), 15607-15607 (2017-11-17)
Gallic acid (GA) has been reported to have beneficial effects on cancer, vascular calcification, and diabetes-induced myocardial dysfunction. We hypothesized that GA controls hypertension via oxidative stress response regulation in an animal model for essential hypertension. Spontaneously hypertensive rats (SHRs)
Xuren Gao et al.
Molecular and cellular endocrinology, 506, 110759-110759 (2020-02-18)
To investigate the role of miR-411-5p and miR-434-3p in osteoblast differentiation in particulate-induced osteolysis. A mouse model of osteolysis and an in vitro osteolysis model were constructed. The expressions of molecules were detected using qRT-PCR and western blot. Alkaline phosphatase
Jie Xiao et al.
Neuroreport, 29(9), 723-730 (2018-04-07)
MicroRNAs (miRNAs) have been documented as critical regulators in ischemia/reperfusion-induced neuronal death. A better understanding of miRNA-mediated molecular mechanisms in ischemia/reperfusion-induced neuronal death may provide therapeutic targets for cerebral ischemia/reperfusion injury. A growing body of evidence suggests that miR-429 is

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service