Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AGCTCCTTCAGGCAGTGAGAGCCTTCCTCCCGCCAGCGGTGCTTCCAGCAACTCCAGCAACGCCACCACCAGCAGCAGCGAGGAGATGCGTCCCATCAAGACGGAGCCTGGCCTGTCATCTCACTACGGGCACAGCAGCTCCGTGTCCCAGACGTTCTCAGTCAGTGCGATGTCTGGCCATGGGCCCTCCATCCACCCTGTCCTCTCGGCCCTGAAGCTCTCCCCACAAGGCTATGCGTCTCCCGTCAGCCAGTCTCCACAGACCAGCTCCAAGCAGGACTCTTGGAACAGCCTGGTCTTGGCCGACAGTCACGGGGACATAATCACTGCGTAATCTTCCCTCTTCCCTCCTCAAATTCCTGCACGGACCTGGGACTTGGAGGATAGCAAAGAAGGAGGCC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... GATA4(2626)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Yihua Pei et al.
Oncotarget, 7(47), 77890-77901 (2016-10-28)
GATA4 is a zinc finger DNA-binding protein that plays an important role in mammalian liver development. However, the effects of GATA4 in hepatoblastoma (HB), a common liver cancer in pediatric patients, remain largely unknown. In this study, we demonstrate that
Caterina Negroni et al.
EBioMedicine, 59, 102941-102941 (2020-08-19)
Meningiomas are the most common primary intracranial tumours. They are classified as grade I, II, and III based on their histopathological features. While most meningiomas can be managed by surgery alone, adjuvant treatment may be required in case of recurrent
Li Jin et al.
Scientific reports, 7(1), 15607-15607 (2017-11-17)
Gallic acid (GA) has been reported to have beneficial effects on cancer, vascular calcification, and diabetes-induced myocardial dysfunction. We hypothesized that GA controls hypertension via oxidative stress response regulation in an animal model for essential hypertension. Spontaneously hypertensive rats (SHRs)
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU085401-50UG | 04061831373691 |
| EHU085401-20UG | 04061828620999 |