Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ACAGGGTCTGAAGGACTGGATTGGCCAAACATCAGACCTGTCTTCCAAGGAGACCAAGTCCTGGCTACATCCCAGCCTGTGGTTACAGTGCAGACAGGCCATGTGAGCCACCGCTGCCAGCACAGAGCGTCCTTCCCCCTGTAGACTAGTGCCGTAGGGAGTACCTGCTGCCCCAGCTGACTGTGGCCCCCTCCGTGATCCATCCATCTCCAGGGAGCAAGACAGAGACGCAGGAATGGAAAGCGGAGTTCCTAACAGGATGAAAGTTCCCCCATCAGTTCCCCCAGTACCTCCAAGCAAGTAGCTTTCCACATTTGTCACAGAAATCAGAGGAGAGACGGTGTTGGGAGCCCTTTGGAGAACGCCAGTCTCCCAGGCCCCCTGCATCTATCGAGTTTGCAATGTCACAACCTCTCTGATCTTGTGCTCAGCA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... CTSB(1508)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Cathepsin B as a potential prognostic and therapeutic marker for human lung squamous cell carcinoma.
Fengming Gong et al.
Molecular cancer, 12(1), 125-125 (2013-10-22)
The lung squamous cell carcinoma survival rate is very poor despite multimodal treatment. It is urgent to discover novel candidate biomarkers for prognostic assessment and therapeutic targets to lung squamous cell carcinoma (SCC). Herein a two-dimensional gel electrophoresis and ESI-Q-TOF
Ana Mitrović et al.
European journal of cell biology, 96(6), 622-631 (2017-05-13)
Cathepsins B and X are lysosomal cysteine carboxypeptidases suggested as having a redundant role in cancer. They are involved in a number of processes leading to tumor progression but their role in the epithelial-mesenchymal transition (EMT) remains unknown. We have
Xin Zhang et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 107, 390-396 (2018-08-14)
Resistance to adjuvant radiotherapy is a major cause of treatment failure in patients with glioblastoma (GBM). Recently, the role of lysosome, especially lysosomal proteases, in radioresistance is being paid more and more attention to. Here, we investigated the radioresistant role
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU085641-50UG | 04061828387755 |
| EHU085641-20UG | 04061831354782 |