Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGAAAAGAGCCGAGTGGACTAAGATTCAACAAACTATTTTTGAATGAAGATGATAAACCACATAATCCTATGGTAAATGCTGGAGCAATTGTTGTGACTTCACTAATAAAGCAAGGAGTAAATAATGCTGAAAAATTTGACTATGTCATGCAGTTTTTGAATAAGATGGCTGGTAATGAATATGTTGGATTCAGTAATGCAACGTTTCAGTCTGAAAGAGAAAGTGGAGATCGAAATTTTGCAATAGGATATTACTTAAAAGAAAAGAAGTGTTTTCCAGAAGGCACAGACATGGTTGGTATATTAGACTTCTACTTCCAGCTGTGCTCCATTGAAGTGACTTGTGAATCAGCCAGTGTGATGGCTGCGACACTGGCTAATGGTGGTTTCTGCCCAATTACTGGTGAAAGAGTACTGAGCCCTGAAGCAGTTC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... GLS(2744)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Jae-Seon Lee et al.
Biochemical and biophysical research communications, 477(3), 374-382 (2016-06-25)
We found that non-small cell lung cancer (NSCLC) is remarkably sensitive to the regulation of glutamine supply by testing the metabolic dependency of 11 cancer cell lines against regulation of glycolysis, autophagy, fatty acid synthesis, and glutamine supply. Glutamine is
Denis A Mogilenko et al.
Cell, 177(5), 1201-1216 (2019-04-30)
Innate immune responses are intricately linked with intracellular metabolism of myeloid cells. Toll-like receptor (TLR) stimulation shifts intracellular metabolism toward glycolysis, while anti-inflammatory signals depend on enhanced mitochondrial respiration. How exogenous metabolic signals affect the immune response is unknown. We
Lisha Xiang et al.
Cell death & disease, 10(2), 40-40 (2019-01-25)
Cancer cells re-program their metabolic machinery to meet the requirements of malignant transformation and progression. Glutaminase 1 (GLS1) was traditionally known as a mitochondrial enzyme that hydrolyzes glutamine into glutamate and fuels rapid proliferation of cancer cells. However, emerging evidence
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU085901-20UG | 04061831354836 |
| EHU085901-50UG | 04061828388004 |