Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CTGCCGAACATCTGACTAGCCACAAGTATGTTACCCAGATGTAGAATTTTCATCACTAAACAATCATGCTAAAGAGGAAAGGACAGTGTGCTTGGTTAGAGTAAAGGACGAGGTCATTAGCCATATTGTATATATCGTCAAGCAACACACACAAAAGTTCCTCAGCCACAAGACATCCACATATTGCATGTTAACCAGAAGAAAAGACAACATTTTCCGGAAATCCACTGCACACTGTTGCCTATACACTTTGTACATTTAATTGATATTTGTGCTGAGGTGATATTCCTGTCTAAAAGAACAACATTGTCTTTCTTTTCTAGCACAGAGTTATGCATTCAAAGATGCATACCTAGTTAGTTTCCTATATATTCATGCCATCTTGAAAAGACAGACTATGG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... MBNL1(4154)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Łukasz J Sznajder et al.
Nature communications, 11(1), 2022-2022 (2020-04-26)
The thymus is a primary lymphoid organ that plays an essential role in T lymphocyte maturation and selection during development of one arm of the mammalian adaptive immune response. Although transcriptional mechanisms have been well documented in thymocyte development, co-/post-transcriptional
Svetlana S Itskovich et al.
Nature communications, 11(1), 2369-2369 (2020-05-14)
Despite growing awareness of the biologic features underlying MLL-rearranged leukemia, targeted therapies for this leukemia have remained elusive and clinical outcomes remain dismal. MBNL1, a protein involved in alternative splicing, is consistently overexpressed in MLL-rearranged leukemias. We found that MBNL1
Sandra Fischer et al.
RNA (New York, N.Y.), 26(5), 648-663 (2020-03-05)
Hypoxia is a hallmark of solid cancers, supporting proliferation, angiogenesis, and escape from apoptosis. There is still limited understanding of how cancer cells adapt to hypoxic conditions and survive. We analyzed transcriptome changes of human lung and breast cancer cells
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU086561-20UG | 04061831354904 |
| EHU086561-50UG | 04061828388592 |