Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGAAAGGTCTCAGAAGAAATTGAAGACATCATCAAAAAGGGGGAAACACAAACTCTTTAGAACATAACAGAATATATCTAAGGGTATTCTATGTGCTAATATAAAATATTTTTAACACTTGAGAACAGGGATCTGGGGGATCTCCACGTTTGATCCATTTTCAGCAGTGCTCTGAAGGAGTATCTTACTTGGGTGATTCCTTGTTTTTAGACTATAAAAAGAAACTGGGATAGGAGTTAGACAATTTAAAAGGGGTGTATGAGGGCCTGAAATATGTGACAAATGAATGTGAGTACCCCTTCTGTGAACACTGAAAGCTATTCTCTTGAATTGATCTTAAGTGTCTCCTTGCTCTGGTAAAAGATAGATTTGTAGCTCACTTGATGATGGTGCTGGTGAAT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... GGCT(79017)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Hiroko Takagi et al.
Anticancer research, 39(9), 4811-4816 (2019-09-15)
γ-Glutamylcyclotransferase (GGCT) is highly expressed in many forms of cancer, and is a promising therapeutic target. The present study investigated whether inhibition of GGCT enhanced the antiproliferative effects of the drug docetaxel in prostate cancer cells. Immunohistochemistry and western blot
Eiki Hanada et al.
Anticancer research, 39(4), 1893-1898 (2019-04-07)
γ-Glutamylcyclotransferase (GGCT), a key enzyme involved in glutathione metabolism, catalyzes a specific reaction that generates 5-oxoproline and free amino acids from the γ-glutamyl peptide. Inhibition of GGCT is a promising therapeutic strategy for the treatment of various cancers. Immuno-histochemistry was
Tetsuyuki Takahashi et al.
Biochemical and biophysical research communications, 516(2), 388-396 (2019-06-21)
Inhibition of prostaglandin E2 signaling via EP2/EP4 prostanoid receptors suppresses Insulin-like growth factor (IGF)-1-induced proliferation of pancreatic cancer BxPC-3 cells. To better understand the mechanism of EP2/EP4 signaling for controlling cell proliferation, we performed metabolome analyses in BxPC-3 cells treated with IGF-1
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU086711-20UG | 04061828622092 |
| EHU086711-50UG | 04061828388745 |