Skip to Content
Merck
CN

EHU087041

MISSION® esiRNA

targeting human BCL2L1

Sign In to View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGTTTGTGGCCTCAGAATTGATCATTTTCCCCCCACTCTCCCCACACTAACCTGGGTTCCCTTTCCTTCCATCCCTACCCCCTAAGAGCCATTTAGGGGCCACTTTTGACTAGGGATTCAGGCTGCTTGGGATAAAGATGCAAGGACCAGGACTCCCTCCTCACCTCTGGACTGGCTAGAGTCCTCACTCCCAGTCCAAATGTCCTCCAGAAGCCTCTGGCTAGAGGCCAGCCCCACCCAGGAGGGAGGGGGCTATAGCTACAGGAAGCACCCCATGCCAAAGCTAGGGTGGCCCTTGCAGTTCAGCACCACCCTAGTCCCTTCCCCTCCCTGGCTCCCATGACCATACTGAGGGACCAACTGGGCCCAAGACAGATGCCCCAGAGCTGTTTATGGCCTCAGCTGCCTCACTTCCTACAAGAGCAGCCTGTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yun Jung Choi et al.
Scientific reports, 9(1), 7193-7193 (2019-05-12)
Mantle cell lymphoma (MCL) is typically an aggressive and rare form of non-Hodgkin lymphoma (NHL) with a poor prognosis despite recent advances in immunochemotherapy and targeted therapeutics against NHL. New therapeutic agents are needed for MCL. In this study, we
Jihong Shi et al.
Laboratory investigation; a journal of technical methods and pathology, 98(11), 1423-1437 (2018-08-10)
Hypertrophic scarring is a serious fibrotic skin disease, and the abnormal activation of hypertrophic scar fibroblasts (HSFs) intensifies its pathogenesis. Our previous studies have demonstrated that the dysregulation of autophagy in HSFs is associated with fibrosis. However, knowledge regarding the
Sahar Taghavi et al.
International journal of pharmaceutics, 516(1-2), 301-312 (2016-11-15)
In this project, synergistic cancer cell death was achieved by a targeted delivery system comprising Bcl-xL-specific shRNA and a very low DOX content, which simultaneously activated an intrinsic apoptotic pathway. A modified branched polyethylenimine (PEI 10kDa) was grafted through polyethylene
Sachie Hirai et al.
Biochemical and biophysical research communications, 526(2), 417-423 (2020-04-01)
Although most EGFR-mutant lung adenocarcinomas initially respond to EGFR inhibitors, disease progression almost inevitably occurs. We previously reported that two EGFR-mutant lung adenocarcinoma cell lines, HCC827 and H1975, contain subpopulations of cells that display an epithelial-to-mesenchymal phenotype and can thrive
Wenshu Chen et al.
Molecular carcinogenesis, 55(11), 1858-1866 (2015-11-27)
The interaction between epithelial and stromal cells through soluble factors such as cytokines plays an important role in carcinogenesis. Breaking this cancer-promoting interaction poses an opportunity for cancer prevention. The tumor-promoting function of interleukin 6 (IL-6) has been documented; however

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service