Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AAGGTCACCACCAACCAGACCAGTCCCTGGTCATAGGTCTGAAAGGGCAATCCGGACCCAGCCCAAGCAACTGATTGTGGATGACTTGAAGGGTTCCTTGAAAGAGGACCTGACACAGCACAAGTTCATTTGTGAACAGTGTGGGAAGTGCAAGTGTGGAGAATGCACTGCTCCCAGGACCCTACCATCCTGTTTGGCCTGTAACCGGCAGTGCCTTTGCTCTGCTGAGAGCATGGTGGAATATGGAACCTGCATGTGCTTAGTCAAGGGCATCTTCTACCACTGCTCCAATGACGACGAAGGGGATTCCTATTCAGATAATCCTTGCTCCTGTTCACAATCACACTGCTGCTCTAGATACCTGTGTATGGGAGCCATGTCTTTATTTTTACCTTGCTTACTCTGTTATCCTCCTGCTAAAGGATGCCTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... SPRY1(10252)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Z-S Yuan et al.
European review for medical and pharmacological sciences, 21(22), 5072-5080 (2017-12-12)
Gliomas are accompanied with high mortality owning to their invasive peculiarity and vulnerability to drug resistance. miR-21 is a vital oncogenic miRNA that regulates drug resistance of tumor cells. This study aims to elucidate the function of miR-21 in human
Juliana F Germano et al.
Virology, 529, 169-176 (2019-02-04)
Coxsackievirus B is a significant human pathogen and is a leading cause of myocarditis. We and others have observed that certain enteroviruses including coxsackievirus B cause infected cells to shed extracellular vesicles containing infectious virus. Recent reports have shown that
Naoki Terada et al.
Journal of cellular biochemistry, 115(9), 1505-1515 (2014-03-08)
Prostate cancer is a heterogeneous disease and thus, it is important to understand whether among the heterogeneous collection of cell types, androgen-deprivation insensitive cells exist prior to hormonal manipulation. We established several LNCaP subclones with distinct insensitivities to androgen deprivation
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU087521-50UG | 04061828396917 |
| EHU087521-20UG | 04061831355055 |