Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CTTGGCTTCCTTGTGCCTTAAAAAACCTGCCTTCCTGCAGCCACACACCCACCCGGGGTGTCCTGGGGACCCAAGGGGTGGGGGGGTCACACCAGAGAGAGGCAGGGGGCCTGGCCGGCTCCTGCAGGATCATGCAGCTGGGGCGCGGCGGCCGCGGCTGCGACACCCCAACCCCAGCCCTCTAATCAAGTCACGTGATTCTCCCTTCACCCCGCCCCCAGGGCCTTCCCTTCTGCCCCCAGGCGGGCTCCCCGCTGCTCCAGCTGCGGAGCTGGTCGACATAATCTCTGTATTATATACTTTGCAGTTGCAGACGTCTGTGCCTAGCAATATTTCCAGTTGACCAAATATTCTAATCTTTTTTCATTTATATGCAAAAGAAATAGTTTTAAGTAACTTTTTATAGCAAGATGATACAATGGTATGAGTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... PTBP1(5725)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Kohei Taniguchi et al.
International journal of molecular sciences, 19(5) (2018-04-27)
Pyruvate kinase is known as the glycolytic enzyme catalyzing the final step in glycolysis. In mammals, two different forms of it exist, i.e., pyruvate kinase M1/2 (PKM) and pyruvate kinase L/R (PKLR). Also, PKM has two isoforms, i.e., PKM1 and
High expression of PTBP1 promote invasion of colorectal cancer by alternative splicing of cortactin.
Zhi-Na Wang et al.
Oncotarget, 8(22), 36185-36202 (2017-04-14)
Polypyrimidine tract-binding protein 1 (PTBP1) involving in almost all steps of mRNA regulation including alternative splicing metabolism during tumorigenesis due to its RNA-binding activity. Initially, we found that high expressed PTBP1 and poor prognosis was interrelated in colorectal cancer (CRC)
Hidekazu Takahashi et al.
Molecular cancer therapeutics, 14(7), 1705-1716 (2015-04-24)
Polypyrimidine tract-binding protein (PTBP1) is an RNA-binding protein with various molecular functions related to RNA metabolism and a major repressive regulator of alternative splicing, causing exon skipping in numerous alternatively spliced pre-mRNAs. Here, we have investigated the role of PTBP1
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU088121-50UG | 04061831373837 |
| EHU088121-20UG | 04061831355178 |