Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGCCAGTATGGTGCATTCTTTGATTGAAGCATATGCACTGCATAAGCAGATGAGGATAGTTAAGCCTAAAGTGGCCTCCATGGAGGAGATGGCCACCTTCCACACTGATGCTTATCTGCAGCATCTCCAGAAGGTCAGCCAAGAGGGCGATGATGATCATCCGGACTCCATAGAATATGGGCTAGGTTATGACTGCCCAGCCACTGAAGGGATATTTGACTATGCAGCAGCTATAGGAGGGGCTACGATCACAGCTGCCCAATGCCTGATTGACGGAATGTGCAAAGTAGCAATTAACTGGTCTGGAGGGTGGCATCATGCAAAGAAAGATGAAGCATCTGGTTTTTGTTATCTCAATGATGCTGTCCTGGGAATATTACGATTGCGACGGAAATTTGAGCGTATTCTCTACGTGGATTTGGATCTGCA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... HDAC8(55869)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
HDAC8 Regulates a Stress Response Pathway in Melanoma to Mediate Escape from BRAF Inhibitor Therapy.
Michael F Emmons et al.
Cancer research, 79(11), 2947-2961 (2019-04-17)
Melanoma cells have the ability to switch to a dedifferentiated, invasive phenotype in response to multiple stimuli. Here, we show that exposure of melanomas to multiple stresses including BRAF-MEK inhibitor therapy, hypoxia, and UV irradiation leads to an increase in
Zhouxiang Jin et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 84, 1645-1653 (2016-11-17)
Despite the use of novel anti-myeloma agents,nearly all patients will eventually relapse or become refractory to drug treatment. New and more effective drugs for multiple myeloma (MM) are urgently needed. The JAK-STAT signaling pathway is important in the proliferation of
Yunhe Zhang et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(6), 7295-7310 (2020-04-14)
Histone deacetylases (HDACs) have been shown to alleviate renal fibrosis, however, the role of individual HDAC isoforms in this process is poorly understood. In this study, we examined the role of HDAC8 in the development of renal fibrosis and partial
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU088741-50UG | 04061828398102 |
| EHU088741-20UG | 04061828623808 |