Skip to Content
Merck
CN

EHU090661

MISSION® esiRNA

targeting human USP15

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGTGTATCCTGGACCCATTGATAACTCTGGACTTCTCAAAGATGGTGATGCCCAGTCACTTAAGGAACACCTTATTGATGAATTGGATTACATACTGTTGCCAACTGAAGGTTGGAATAAACTTGTCAGCTGGTACACATTGATGGAAGGTCAAGAGCCAATAGCACGAAAGGTGGTTGAACAGGGTATGTTTGTAAAGCACTGCAAAGTAGAAGTATATCTCACAGAATTGAAGCTATGTGAAAATGGAAACATGAATAATGTTGTAACTCGAAGATTTAGCAAAGCTGACACAATAGATACAATTGAAAAGGAAATAAGAAAAATCTTCAGTATTCCAGATGAAAAGGAGACCAGATTGTGGAACAAATACATGAGTAACACATTTGAACCACTGAATAAACCAGACAGCACCATTCAGGATGCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ke Xu et al.
Oncology letters, 15(3), 3846-3851 (2018-02-23)
Glioblastoma multiforme (GBM) is one of the most aggressive types of brain tumor worldwide. Despite the advances made in treatment and research, the median survival time for GBM patients remains <1.5 years, providing impetus for the identification of potential novel
Zhi-Jun Su et al.
Scientific reports, 7, 40246-40246 (2017-01-12)
Hepatitis B virus X protein (HBx) plays important roles in viral replication and the development of hepatocellular carcinoma. HBx is a rapid turnover protein and ubiquitin-proteasome pathway has been suggested to influence HBx stability as treatment with proteasome inhibitors increases
Paul van den Berk et al.
Cell reports, 33(13), 108533-108533 (2020-12-31)
Altering ubiquitination by disruption of deubiquitinating enzymes (DUBs) affects hematopoietic stem cell (HSC) maintenance. However, comprehensive knowledge of DUB function during hematopoiesis in vivo is lacking. Here, we systematically inactivate DUBs in mouse hematopoietic progenitors using in vivo small hairpin RNA (shRNA)

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service