Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGTGTATCCTGGACCCATTGATAACTCTGGACTTCTCAAAGATGGTGATGCCCAGTCACTTAAGGAACACCTTATTGATGAATTGGATTACATACTGTTGCCAACTGAAGGTTGGAATAAACTTGTCAGCTGGTACACATTGATGGAAGGTCAAGAGCCAATAGCACGAAAGGTGGTTGAACAGGGTATGTTTGTAAAGCACTGCAAAGTAGAAGTATATCTCACAGAATTGAAGCTATGTGAAAATGGAAACATGAATAATGTTGTAACTCGAAGATTTAGCAAAGCTGACACAATAGATACAATTGAAAAGGAAATAAGAAAAATCTTCAGTATTCCAGATGAAAAGGAGACCAGATTGTGGAACAAATACATGAGTAACACATTTGAACCACTGAATAAACCAGACAGCACCATTCAGGATGCT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... USP15(9958)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Ke Xu et al.
Oncology letters, 15(3), 3846-3851 (2018-02-23)
Glioblastoma multiforme (GBM) is one of the most aggressive types of brain tumor worldwide. Despite the advances made in treatment and research, the median survival time for GBM patients remains <1.5 years, providing impetus for the identification of potential novel
Zhi-Jun Su et al.
Scientific reports, 7, 40246-40246 (2017-01-12)
Hepatitis B virus X protein (HBx) plays important roles in viral replication and the development of hepatocellular carcinoma. HBx is a rapid turnover protein and ubiquitin-proteasome pathway has been suggested to influence HBx stability as treatment with proteasome inhibitors increases
Paul van den Berk et al.
Cell reports, 33(13), 108533-108533 (2020-12-31)
Altering ubiquitination by disruption of deubiquitinating enzymes (DUBs) affects hematopoietic stem cell (HSC) maintenance. However, comprehensive knowledge of DUB function during hematopoiesis in vivo is lacking. Here, we systematically inactivate DUBs in mouse hematopoietic progenitors using in vivo small hairpin RNA (shRNA)
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU090661-50UG | 04061828360451 |
| EHU090661-20UG | 04061831355604 |