Skip to Content
Merck
CN

EHU090771

MISSION® esiRNA

targeting human VPS72

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human VPS72

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGATGAAGGGGATGAACCATCCAGTGATGGAGAAGCAGAAGAGCCAAGAAGGAAGCGCCGAGTAGTCACCAAGGCCTATAAGGAACCTCTCAAGAGCTTAAGGCCTCGAAAGGTCAACACCCCGGCTGGTAGCTCTCAGAAGGCGCGAGAAGAGAAGGCACTACTGCCATTAGAACTACAAGATGACGGCTCTGACAGTCGGAAGTCTATGCGTCAGTCTACAGCTGAGCATACACGACAAACGTTCCTTCGGGTACAGGAGAGGCAGGGCCAGTCAAGACGGCGAAAGGGGCCCCACTGTGAGCGGCCACTAACCCAGGAGGAACTGCTCCGGGAGGCCAAGATCACAGAAGAGCTTAATTTACGGTCACTGGAGACATATGAGCGGCTCGAGGCTGATAAAAAGAAGCAGGTTCATAAGAAGCGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Seyedeh Saideh Daryabari et al.
Journal of cellular physiology, 235(10), 6660-6672 (2020-01-29)
Gastric adenocarcinoma, like other cancers, is a multifactorial genetic disease, and metastasis of cancer cells is one of the main features of this illness. The expression levels of the CFL1 gene have been modulated in this pathway. Using small interfering
Jessica Wayt et al.
Molecular biology of the cell, 32(3), 226-236 (2020-12-17)
Although the actomyosin cytoskeleton has been implicated in clathrin-mediated endocytosis, a clear requirement for actomyosin in clathrin-independent endocytosis (CIE) has not been demonstrated. We discovered that the Rho-associated kinase ROCK2 is required for CIE of MHCI and CD59 through promotion
Daniel L Galvan et al.
The Journal of clinical investigation, 129(7), 2807-2823 (2019-05-08)
Phosphorylation of Dynamin-related protein1 (Drp1) represents an important regulatory mechanism for mitochondrial fission. Here we established the role of Drp1 Serine 600 (S600) phosphorylation on mitochondrial fission in vivo, and assessed the functional consequences of targeted elimination of the Drp1S600
Daniel Moreno-Andrés et al.
Cells, 9(7) (2020-07-28)
The eukaryotic nucleus remodels extensively during mitosis. Upon mitotic entry, the nuclear envelope breaks down and chromosomes condense into rod-shaped bodies, which are captured by the spindle apparatus and segregated during anaphase. Through telophase, chromosomes decondense and the nuclear envelope

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service