Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGCATAGATGCCAGTCAACCAGATGTTGGAAGCTGGCTCAAGTACATTAGATTCGCTGGCTGTTATGATCAGCACAACCTTGTTGCATGCCAGATAAATGATCAGATATTCTATAGAGTAGTTGCAGACATTGCGCCGGGAGAGGAGCTTCTGCTGTTCATGAAGAGCGAAGACTATCCCCATGAAACTATGGCGCCGGATATCCACGAAGAACGGCAATATCGCTGCGAAGACTGTGACCAGCTCTTTGAATCTAAGGCTGAACTAGCAGATCACCAAAAGTTTCCATGCAGTACTCCTCACTCAGCATTTTCAATGGTTGAAGAGGACTTTCAGCAAAAACTCGAAAGCGAGAATGATCTCCAAGAGATACACACGATCCAGGAGTGTAAGGAATGTGACCAAGTTTTTCCTGATTTGCAAAGCC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... MECOM(2122), EVI1(2122)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Anjan Kumar Pradhan et al.
PloS one, 6(9), e25370-e25370 (2011-10-08)
EVI1 (Ecotropic Viral Integration site I), which was originally identified as a myeloid transforming gene by means of retroviral insertional mutagenesis in mouse leukemia, encodes a nuclear DNA binding zinc finger protein. The presence of zinc fingers that are able
F Mateo et al.
Oncogene, 36(19), 2737-2749 (2016-12-20)
Inhibitors of the mechanistic target of rapamycin (mTOR) are currently used to treat advanced metastatic breast cancer. However, whether an aggressive phenotype is sustained through adaptation or resistance to mTOR inhibition remains unknown. Here, complementary studies in human tumors, cancer
Gerwin Heller et al.
Journal of hematology & oncology, 8, 28-28 (2015-04-18)
The transcription factor Ecotropic Virus Integration site 1 (EVI1) regulates cellular proliferation, differentiation, and apoptosis, and its overexpression contributes to an aggressive course of disease in myeloid leukemias and other malignancies. Notwithstanding, knowledge about the target genes mediating its biological
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU090781-20UG | 04061831355635 |
| EHU090781-50UG | 04061828360574 |