Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCCTCTCACTTTGGTTGGAACTTTAGGGGGTGGGAGGGGGCGTTGGATTTAAAAATGCCAAAACTTACCTATAAATTAAGAAGAGTTTTTATTACAAATTTTCACTGCTGCTCCTCTTTCCCCTCCTTTGTCTTTTTTTTCATCCTTTTTTCTCTTCTGTCCATCAGTGCATGACGTTTAAGGCCACGTATAGTCCTAGCTGACGCCAATAATAAAAAACAAGAAACCAAGTGGGCTGGTATTCTCTCTATGCAAAATGTCTGTTTTAGTTGGAATGACTGAAAGAAGAACAGCTGTTCCTGTGTTCTTCGTATATACACACAAAAAGGAGCGGGCAGGGCCGCTCGATGCCTTTGCTGTTTAGCTTCCTCCAGAGGAGGGGACTTGTAGGAATCTGCCTTCCAGCCCAGACCCCCAGTGTATTTT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... GRB2(2885)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Yueyue Yang et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 133, 111056-111056 (2021-01-01)
Pulmonary arterial hypertension (PAH) is a progressive and lethal cardiopulmonary. Pulmonary vascular remodeling (PVR) caused by excessive proliferation and apoptosis resistance of pulmonary artery smooth muscle cells (PASMCs) is the chief pathological feature of PAH. Dioscin is a natural product
Mathieu J F Crupi et al.
Oncogene, 39(6), 1361-1377 (2019-10-28)
The RET receptor tyrosine kinase plays important roles in regulating cellular proliferation, migration, and survival in the normal development of neural crest derived tissues. However, aberrant activation of RET, through oncogenic mutations or overexpression, can contribute to tumourigenesis, regional invasion
Yolaine Cavignac et al.
PloS one, 10(6), e0131614-e0131614 (2015-06-30)
While it is well established that human cytomegalovirus (HCMV) upregulates many cellular proteins and incorporates several of them into its virion, little is known about the functional relevance of such virus-host interactions. Two cellular proteins, Grb2 and DDX3, gained our
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU091241-20UG | 04061828596287 |
| EHU091241-50UG | 04061828361014 |