Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TCAGACTTGGTTCCTTCAACCTAGAGAAAGTTGAAAACCCAGCTGAAGTCATTAGAGAACTTATTTGTTATTGCTTGGACACCATTGCAGAAAATCAAGCCAAAAATGAGCACCTGCAGAAAGAAAATGAAAGGCTTCTGAGAGATTGGAATGATGTTCAAGGACGATTTGAAAAATGTGTGAGTGCTAAGGAAGCTTTGGAGACTGATCTTTATAAGCGGTTTATTCTGGTGTTGAATGAGAAGAAAACAAAAATCAGAAGTTTGCATAATAAATTATTAAATGCAGCTCAAGAACGAGAAAAGGACATCAAACAAGAAGGGGAAACTGCAATCTGTTCTGAAATGACTGCTGACCGAGATCCAGTCTATGATGAGAGTACTGATGAGGAAAGTGAAAACCAAACTGATCTCTCTGGGTTGGCTT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... XRCC4(7518)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Wen Li et al.
Nature cell biology, 21(10), 1273-1285 (2019-09-25)
Chromosome translocation is a major cause of the onset and progression of diverse types of cancers. However, the mechanisms underlying this process remain poorly understood. Here, we identified a non-homologous end-joining protein, IFFO1, which structurally forms a heterotetramer with XRCC4.
Idit Hazan et al.
Cell reports, 29(3), 560-572 (2019-10-17)
DNA double-strand breaks (DSBs) are deleterious and tumorigenic but could also be essential for DNA-based processes. Yet the landscape of physiological DSBs and their role and repair are still elusive. Here, we mapped DSBs at high resolution in cancer and
Masahiro Terasawa et al.
PLoS genetics, 10(8), e1004563-e1004563 (2014-08-29)
DNA double-strand breaks (DSBs) can be repaired by one of two major pathways-non-homologous end-joining (NHEJ) and homologous recombination (HR)-depending on whether cells are in G1 or S/G2 phase, respectively. However, the mechanisms of DSB repair during M phase remain largely
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU091461-20UG | 04061828596454 |
| EHU091461-50UG | 04061828361212 |