Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TCACCATCCCCATTAGACCTACGAATAAAGCATCCGGTTCTAAAATTAATTTGTTGCAGCTTTGTAAATATTTCTTTAAGATTCAGCCTGAGAGTTAGGAGAAATATTTCAGAGCCAAAAGTGCCTTATACAACCTTAGCCTATTATAGTAAATCATTCAAGGATTCAGAATTTTGCAGTCACAGAAGAGTGTATTTATTATGTAGAATGAATGAGGGTACTGTCACCTGCCTTAATGTAGGTAGGCCCAGAGTCTTACATTTAAGATCTTACATGCAGTTATAAAACCGCCACAGTCTTCAATCCAGATTTGAAGACTCATGCCATAGGTGACATTCTAAAATACCATTAAAGCCACTTAAATGTTAAATAAGAATATACATGCACATCAGCTCAATGT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... RAB27A(5873)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Dajiang Guo et al.
International journal of cancer, 144(12), 3070-3085 (2018-12-18)
Despite recent advances in targeted and immune-based therapies, advanced stage melanoma remains a clinical challenge with a poor prognosis. Understanding the genes and cellular processes that drive progression and metastasis is critical for identifying new therapeutic strategies. Here, we found
Meng Shen et al.
Cancer research, 79(14), 3608-3621 (2019-05-24)
Cancer-secreted, extracellular vesicle (EV)-encapsulated miRNAs enable cancer cells to communicate with each other and with noncancerous cells in tumor pathogenesis and response to therapies. Here, we show that treatment with a sublethal dose of chemotherapeutic agents induces breast cancer cells
Hye-Jin Boo et al.
Nature communications, 7, 12961-12961 (2016-09-27)
Nicotinic acetylcholine receptors (nAChRs) binding to the tobacco-specific carcinogen 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) induces Ca2+ signalling, a mechanism that is implicated in various human cancers. In this study, we investigated the role of NNK-mediated Ca2+ signalling in lung cancer formation. We show
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU091501-20UG | 04061831355789 |
| EHU091501-50UG | 04061828361250 |