Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TTGCTGTTCCTCATCTGTGCTTATCAGAATAACAAAGAACTCTTGTCTAAAGGCTTATACAGAGGACATGATGAAGAATTGATATCACATTATAGAAGAGAATGTTTGCTAAAATTAAATGAGCAAGCCGCAGAACTCTTCGAATCTGGAGAGGATCGAGAAGTAAACAATGGTTTGATTATCATGAATGAGTTTATTGTCCCATTTTTGCCATTATTACTGGTGGATGAAATGGAAGAAAAGGATATACTAGCTGTAGAAGATATGAGAAATCGATGGTGTTCCTACCTTGGTCAAGAAATGGAACCACACCTCCAAGAAAAGCTGACAGATTTTTTGCCAAAACTGCTTGATTGTTCTATGGAGATTAAAAGTTTCCATGAGCCACCGAAGTTACCTT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... USP25(29761)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Jian Wen et al.
Molecular immunology, 106, 53-62 (2018-12-24)
The inhibition of tumor necrosis factor receptor-associated factor 3 (TRAF3) degradation induces endotoxin tolerance (ET) in macrophages. However, the mechanisms leading to TRAF3 inhibition by ET are largely unknown. Here, we found that ubiquitin-specific peptidase 25 (USP25), a deubiquitinating enzyme
Changyu Ding et al.
Canadian journal of physiology and pharmacology, 95(5), 481-491 (2017-01-31)
Lipopolysaccharide (LPS) is a key pathogenic factor in sepsis, and its recognition by toll-like receptor 4 (TLR4) can activate two district signaling pathways, leading to activation of transcription factors including NF-κB and interferon regulatory factor 3 (IRF3). Chloroquine (CQ) has
Chen Long et al.
American journal of physiology. Lung cellular and molecular physiology, 318(2), L252-L263 (2019-11-21)
Cigarette smoking increases susceptibility for microbial infection in respiratory system. However, the underlying molecular mechanism(s) is not fully elucidated. Here we report that cigarette smoking extract (CSE) increases bacterial load in lung epithelial cells via downregulation of the ubiquitin-specific protease
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU092431-20UG | 04061831355949 |
| EHU092431-50UG | 04061831374049 |