Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGAGCCAAACGTGACCACTAGCCTCCTGGAGCCAGAGAGTGGGGCTCGTTTGCCGGTTGCTCCAGCCCGGCGCCCAGCCATCTTCCCTGAGCCAGCCGGCGGGTGGTGGGCATGCCTGCCTCACCTTCATCAGGGGGTGGCCAGGAGGGGCCCAGACTGTGAATCCTGTGCTCTGCCCGTGACCGCCCCCCGCCCCATCAATCCCATTGCATAGGTTTAGAGAGAGCACGTGTGACCACTGGCATTCATTTGGGGGGTGGGAGATTTTGGCTGAAGCCGCCCCAGCCTTAGTCCCCAGGGCCAAGCGCTGGGGGGAAGACGGGGAGTCAGGGAGGGGGGGAAATCTCGGAAGAGGGAGGAGTCTGGGAGTGGGGAGGGATGGCCCAGCCTGTAAGATACTGTATATGCGCTGCTGTAGATACCG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... BBC3(27113)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
S-G Xing et al.
European review for medical and pharmacological sciences, 22(13), 4341-4349 (2018-07-20)
Propofol is one of the most commonly used intravenous anesthetic agents used in cancer resections, but the effect of propofol on non-small cell lung cancer (NSCLC) remains unclear. Previous researches have reported that propofol can inhibit extracellular signal-regulated kinase (ERK)
Yu Li et al.
Cancer biomarkers : section A of Disease markers, 20(2), 175-181 (2017-09-05)
Studies in developing animals have demonstrated that when anesthetic agents, such as propofol, are early administered in life, it can lead to neuronal cell death and learning disabilities. However, the mechanisms causing these effects remains unknown. A recent report found that
Longwei Huo et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 92, 347-355 (2017-05-30)
Glioma is the most common primary malignant tumor of the central nervous system. B10 is a new glycosylated derivative of betulinic acid with enhanced cytotoxic activity. The present study was designed to explore the molecular mechanism underlying the anticancer effect
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU093341-20UG | 04061831356144 |
| EHU093341-50UG | 04061828362981 |