Skip to Content
Merck
CN

EHU093341

Sigma-Aldrich

MISSION® esiRNA

targeting human BBC3

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGAGCCAAACGTGACCACTAGCCTCCTGGAGCCAGAGAGTGGGGCTCGTTTGCCGGTTGCTCCAGCCCGGCGCCCAGCCATCTTCCCTGAGCCAGCCGGCGGGTGGTGGGCATGCCTGCCTCACCTTCATCAGGGGGTGGCCAGGAGGGGCCCAGACTGTGAATCCTGTGCTCTGCCCGTGACCGCCCCCCGCCCCATCAATCCCATTGCATAGGTTTAGAGAGAGCACGTGTGACCACTGGCATTCATTTGGGGGGTGGGAGATTTTGGCTGAAGCCGCCCCAGCCTTAGTCCCCAGGGCCAAGCGCTGGGGGGAAGACGGGGAGTCAGGGAGGGGGGGAAATCTCGGAAGAGGGAGGAGTCTGGGAGTGGGGAGGGATGGCCCAGCCTGTAAGATACTGTATATGCGCTGCTGTAGATACCG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Mengya Jiao et al.
Journal of neuroinflammation, 17(1), 251-251 (2020-08-30)
Interleukin-33 (IL-33) is a well-recognized pleiotropic cytokine which plays crucial roles in immune regulation and inflammatory responses. Recent studies suggest that IL-33 and its receptor ST2 are involved in the pathogenesis of neurological diseases. Here, we explore the effect of
Wenyi Liu et al.
Bioengineered, 11(1), 189-200 (2020-02-14)
MicroRNAs (miRNAs) have emerged as critical regulators of neuronal survival during cerebral ischemia/reperfusion injury. Accumulating evidence has shown that miR-211 plays a crucial role in regulating apoptosis and survival in various cell types. However, whether miR-211 is involved in regulating
Longwei Huo et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 92, 347-355 (2017-05-30)
Glioma is the most common primary malignant tumor of the central nervous system. B10 is a new glycosylated derivative of betulinic acid with enhanced cytotoxic activity. The present study was designed to explore the molecular mechanism underlying the anticancer effect
Yu Li et al.
Cancer biomarkers : section A of Disease markers, 20(2), 175-181 (2017-09-05)
Studies in developing animals have demonstrated that when anesthetic agents, such as propofol, are early administered in life, it can lead to neuronal cell death and learning disabilities. However, the mechanisms causing these effects remains unknown. A recent report found that
S-G Xing et al.
European review for medical and pharmacological sciences, 22(13), 4341-4349 (2018-07-20)
Propofol is one of the most commonly used intravenous anesthetic agents used in cancer resections, but the effect of propofol on non-small cell lung cancer (NSCLC) remains unclear. Previous researches have reported that propofol can inhibit extracellular signal-regulated kinase (ERK)

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service