Skip to Content
Merck
CN

EHU093441

MISSION® esiRNA

targeting human ANK3

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGAGCATCAGTTTGACAGCAAAAATGAAGATTTAACCGAGTTACTTAATGGCATGGATGAAGAACTTGATAGCCCAGAAGAGTTAGGGAAAAAGCGTATCTGCAGGATTATCACGAAAGATTTCCCCCAGTATTTTGCAGTGGTTTCCCGGATTAAGCAGGAAAGCAACCAGATTGGTCCTGAAGGTGGAATTCTGAGCAGCACCACAGTGCCCCTTGTTCAAGCATCTTTCCCAGAGGGTGCCCTAACTAAAAGAATTCGAGTGGGCCTCCAGGCCCAGCCTGTTCCAGATGAAATTGTGAAAAAGATCCTTGGAAACAAAGCAACTTTTAGCCCAATTGTCACTGTGGAACCAAGAAGACGGAAATTCCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Tingting Wang et al.
Journal of molecular medicine (Berlin, Germany), 94(12), 1411-1422 (2016-08-19)
Ankyrin G (ANK3) is a member of the Ankyrin family, which functions to provide cellular stability by anchoring the cytoskeleton to the plasma membrane. Deregulation of ANK3 expression has been observed in multiple human cancers but its mechanism remains unknown.
Min Lee et al.
The Journal of cell biology, 219(2) (2020-01-08)
Neuronal GABAergic responses switch from excitatory to inhibitory at an early postnatal period in rodents. The timing of this switch is controlled by intracellular Cl- concentrations, but factors determining local levels of cation-chloride cotransporters remain elusive. Here, we report that
Xiaqin Sun et al.
Proceedings of the National Academy of Sciences of the United States of America, 111(39), 14271-14276 (2014-09-19)
Axon pathology has been widely reported in Alzheimer's disease (AD) patients and AD mouse models. Herein we report that increased miR-342-5p down-regulates the expression of ankyrin G (AnkG), a protein known to play a critical role in establishing selective filtering

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service