Skip to Content
Merck
CN

EHU093481

MISSION® esiRNA

targeting human CFLAR

Sign In to View Organizational & Contract Pricing

Select a Size

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

Key Documents

View All Documentation
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCATCAGGTTGAAGAAGCACTTGATACAGATGAGAAGGAGATGCTGCTCTTTTTGTGCCGGGATGTTGCTATAGATGTGGTTCCACCTAATGTCAGGGACCTTCTGGATATTTTACGGGAAAGAGGTAAGCTGTCTGTCGGGGACTTGGCTGAACTGCTCTACAGAGTGAGGCGATTTGACCTGCTCAAACGTATCTTGAAGATGGACAGAAAAGCTGTGGAGACCCACCTGCTCAGGAACCCTCACCTTGTTTCGGACTATAGAGTGCTGATGGCAGAGATTGGTGAGGATTTGGATAAATCTGATGTGTCCTCATTAATTTTCCTCATGAAGGATTACATGGGCCGAGGCAAGATAAGCAAGGAGAAGAGTTTCTTGGACCTTGTGGTTGAGTTGGAGAAACTAAATCTGGTTGCCCCAGA

Ensembl | human accession no.

ENSG00000003402

NCBI accession no.

NM_003879

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CFLAR(8837), CFLAR(8837)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number
IYT
UUT
YET
CYS
DRS

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Search for a COA

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Tae-Eun Kim et al.
Oncotarget, 8(8), 13957-13970 (2017-01-14)
In this study, we examined the molecular mechanism underlying the resistance of cancer cells to R27T, a glycoengineered version of recombinant human interferon (IFN)-β1a, and sought to overcome R27T resistance through combination therapy. R27T has been shown to induce anti-proliferation
Yao Wang et al.
Frontiers in oncology, 9, 857-857 (2019-09-26)
Immune checkpoint blockade of programmed cell death protein 1 (PD-1) had an impressive long-lasting effect in a portion of advanced-stage melanoma patients, however, this therapy failed to induce responses in several patients; how to increase the objective response rate is
X Song et al.
Cell death & disease, 4, e577-e577 (2013-04-06)
Colorectal cancer is the third leading cause of cancer-related mortality in the world; the main cause of death of colorectal cancer is hepatic metastases, which can be treated with hyperthermia using isolated hepatic perfusion (IHP). In this study, we report
Reyaz ur Rasool et al.
Scientific reports, 6, 18800-18800 (2016-01-06)
The eukaryotic translation initiation factor 4E (eIF4E) is considered as a key survival protein involved in cell cycle progression, transformation and apoptosis resistance. Herein, we demonstrate that medicinal plant derivative 3-AWA (from Withaferin A) suppressed the proliferation and metastasis of
Therese Bredholt et al.
Molecular cancer, 8, 101-101 (2009-11-17)
An organic extract of the recreational herb khat (Catha edulis Forsk.) triggers cell death in various leukemia cell lines in vitro. The chemotherapeutics camptothecin, a plant alkaloid topoisomerase I inhibitor, was tested side-by-side with khat in a panel of acute
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service