Skip to Content
Merck
CN

EHU094381

MISSION® esiRNA

targeting human SKP2

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTCCACGGCATACTGTCTCAGTGTTCCAAGTTGCAGAATCTAAGCCTGGAAGGCCTGCGGCTTTCGGATCCCATTGTCAATACTCTCGCAAAAAACTCAAATTTAGTGCGACTTAACCTTTCTGGGTGTTCTGGATTCTCTGAATTTGCCCTGCAGACTTTGCTAAGCAGCTGTTCCAGACTGGATGAGCTGAACCTCTCCTGGTGTTTTGATTTCACTGAAAAGCATGTACAGGTGGCTGTTGCGCATGTGTCAGAGACCATCACCCAGCTGAATCTTAGCGGCTACAGAAAGAATCTCCAGAAATCAGATCTCTCTACTTTAGTTAGAAGATGCCCCAATCTTGTCCATCTAGACTTAAGTGATAGTGTCATGCTAAAGAATGACTGCTTTCAGGAATTTTTCCAGCTCAACTACCTCCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... SKP2(6502)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品

This item has


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Shirly Lahav-Baratz et al.
Reproductive biomedicine online, 32(3), 308-315 (2016-01-23)
This preliminary study examined a possible effect of long duration repeated hormonal stimulation on the endometrium using a molecular tool. The expression of the hormone stimulated, cell cycle regulators, p27 and its ligase S-phase kinase-interacting protein2 (Skp2), were assessed in
Yingduan Cheng et al.
Oncotarget, 8(2), 1972-1982 (2016-12-29)
Recent findings on the existence of oncogenic fusion genes in a wide array of solid tumors, including head and neck squamous cell carcinoma (HNSCC), suggests that fusion genes have become attractive targets for cancer diagnosis and treatment. In this study
Wei Yan et al.
Cancer biotherapy & radiopharmaceuticals, 34(7), 451-458 (2019-04-27)
Background: Mantle cell lymphoma (MCL) is associated with poor patient prognosis mainly due to incomplete response to chemotherapy. S-phase
Gatha Thacker et al.
Life sciences, 257, 118041-118041 (2020-07-06)
Transcription factor CCAAT/Enhancer binding protein alpha (C/EBPα) is a key regulator of myeloid differentiation, granulopoiesis in particular. Although CEBPA mutations are found in more than 10% in AML, functional inhibition of C/EBPα protein is also widely observed in AML. Here
Fan Yao et al.
Nature communications, 9(1), 2269-2269 (2018-06-13)
Dysregulation of YAP localization and activity is associated with pathological conditions such as cancer. Although activation of the Hippo phosphorylation cascade is known to cause cytoplasmic retention and inactivation of YAP, emerging evidence suggests that YAP can be regulated in

Global Trade Item Number

SKUGTIN
EHU094381-50UG04061831374148
EHU094381-20UG04061831356373

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service