Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CTTGCCGAAATTGAGGACATGATTAAAATTGCAGTGAAGTTTGAAATGTTTTTAGCAAAATCTAATTTTTGCCATAATGTGTCCTCCCTGTCCAAATTGGGAATGACTTAATGTCAATTTGTTTGTTGGTTGTTTTAATAATACTTCCTTATGTAGCCATTAAGATTTATATGAATATTTTCCCAAATGCCCAGTTTTTGCTTAATATGTATTGTGCTTTTTAGAACAAATCTGGATAAATGTGCAAAAGTACCCCTTTGCACAGATAGTTAATGTTTTATGCTTCCATTAAATAAAAAGGACTTAAAATCTGTTAATTATAATAGAAATGCGGCTAGTTCAGAGAGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... HNRNPD(3184)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Shuhong Sun et al.
The Journal of biological chemistry, 291(50), 25823-25836 (2016-10-28)
Autotaxin (ATX) is a key enzyme that converts lysophosphatidylcholine (LPC) into lysophosphatidic acid (LPA), a lysophospholipid mediator that regulates cellular activities through its specific G protein-coupled receptors. The ATX-LPA axis plays an important role in various physiological and pathological processes
Luigi Alfano et al.
Nucleic acids research, 47(8), 4068-4085 (2019-02-26)
DNA double strand break (DSB) repair through homologous recombination (HR) is crucial to maintain genome stability. DSB resection generates a single strand DNA intermediate, which is crucial for the HR process. We used a synthetic DNA structure, mimicking a resection
Huiwen Song et al.
Autophagy, 15(8), 1419-1437 (2019-03-15)
N6-methyladenosine (m6A) mRNA modifications play critical roles in various biological processes. However, no study addresses the role of m6A in macroautophagy/autophagy. Here, we show that m6A modifications are increased in H/R-treated cardiomyocytes and ischemia/reperfusion (I/R)-treated mice heart. We found that
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU094941-20UG | 04061831356434 |
| EHU094941-50UG | 04061828364473 |