Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GTGTGGTTACAGGCGAGGATGGCAGTGAGTCAGAGGCCACCGTCAACGTGAAGATCTTTCAGAAGCTCATGTTCAAGAATGCGCCAACCCCACAGGAGTTCCGGGAGGGGGAAGATGCCGTGATTGTGTGTGATGTGGTCAGCTCCCTCCCACCAACCATCATCTGGAAACACAAAGGCCGAGATGTCATCCTGAAAAAAGATGTCCGATTCATAGTCCTGTCCAACAACTACCTGCAGATCCGGGGCATCAAGAAAACAGATGAGGGCACTTATCGCTGTGAGGGCAGAATCCTGGCACGGGGGGAGATCAACTTCAAGGACATTCAGGTCATTGTGAATGTGCC
Ensembl | human accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... NCAM1(4684)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Yongguang Yang et al.
BMC cell biology, 11, 78-78 (2010-10-20)
The proliferation and final density of Sertoli cells in the testis are regulated by hormones and local factors. Glial cell line-derived neurotrophic factor (GDNF), a distantly related member of the transforming growth factor-β superfamily, and its receptor subunits GDNF family
Natacha Coppieters et al.
Brain research, 1710, 199-208 (2018-12-26)
The neural cell adhesion molecule (NCAM) is a transmembrane protein involved in major cellular processes. The addition of polysialic acid (PSA), a post-translational modification (PTM) almost exclusively carried by NCAM, alters NCAM properties and functions and is therefore tightly regulated.
Chunlei Yu et al.
Toxicology mechanisms and methods, 26(9), 635-643 (2016-11-08)
Curcuma phaeocaulis Val. is a Chinese medicinal herb that is contraindicated during pregnancy for over a thousand years in China. The aims of the present study were to evaluate the effect of curcumol (one of the major components of C.
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU095161-20UG | 04061828599288 |
| EHU095161-50UG | 04061828364695 |