Skip to Content
Merck
CN

EHU095461

Sigma-Aldrich

MISSION® esiRNA

targeting human CCL20

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAAGCAACTTTGACTGCTGTCTTGGATACACAGACCGTATTCTTCATCCTAAATTTATTGTGGGCTTCACACGGCAGCTGGCCAATGAAGGCTGTGACATCAATGCTATCATCTTTCACACAAAGAAAAAGTTGTCTGTGTGCGCAAATCCAAAACAGACTTGGGTGAAATATATTGTGCGTCTCCTCAGTAAAAAAGTCAAGAACATGTAAAAACTGTGGCTTTTCTGGAATGGAATTGGACATAGCCCAAGAACAGAAAGAACCTTGCTGGGGTTGGAGGTTTCACTTGCACATCATGGAGGGTTTAGTGCTTATCTAATTTGTGCCTCACTGGACTTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Qiang Fu et al.
Biotechnology letters, 43(2), 393-405 (2020-11-10)
Myocardial infarction (MI) is a prevalent cardiovascular puzzle and a mainspring of disease-induced mortality. We performed this investigation to detect the role of putative important miRNAs or genes in MI. CCL20 may be a potential therapeutic target, which was directly
Li-Shang Liao et al.
Aging, 12(14), 14849-14862 (2020-06-24)
Recent evidence suggests that CC chemokine ligand 20 (CCL20) is upregulated after subarachnoid hemorrhage (SAH). Here, we investigated the functions of CCL20 in SAH injury and its underlying mechanisms of action. We found that CCL20 is upregulated in an SAH
Masaaki Murakami et al.
The Journal of experimental medicine, 208(1), 103-114 (2011-01-12)
Cognate antigen recognition by CD4(+) T cells is thought to contribute to the tissue specificity of various autoimmune diseases, particularly those associated with class II MHC alleles. However, we show that localized class II MHC-dependent arthritis in F759 mice depends

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service