Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCAAGCAACTTTGACTGCTGTCTTGGATACACAGACCGTATTCTTCATCCTAAATTTATTGTGGGCTTCACACGGCAGCTGGCCAATGAAGGCTGTGACATCAATGCTATCATCTTTCACACAAAGAAAAAGTTGTCTGTGTGCGCAAATCCAAAACAGACTTGGGTGAAATATATTGTGCGTCTCCTCAGTAAAAAAGTCAAGAACATGTAAAAACTGTGGCTTTTCTGGAATGGAATTGGACATAGCCCAAGAACAGAAAGAACCTTGCTGGGGTTGGAGGTTTCACTTGCACATCATGGAGGGTTTAGTGCTTATCTAATTTGTGCCTCACTGGACTTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... CCL20(6364)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Li-Shang Liao et al.
Aging, 12(14), 14849-14862 (2020-06-24)
Recent evidence suggests that CC chemokine ligand 20 (CCL20) is upregulated after subarachnoid hemorrhage (SAH). Here, we investigated the functions of CCL20 in SAH injury and its underlying mechanisms of action. We found that CCL20 is upregulated in an SAH
Qiang Fu et al.
Biotechnology letters, 43(2), 393-405 (2020-11-10)
Myocardial infarction (MI) is a prevalent cardiovascular puzzle and a mainspring of disease-induced mortality. We performed this investigation to detect the role of putative important miRNAs or genes in MI. CCL20 may be a potential therapeutic target, which was directly
Masaaki Murakami et al.
The Journal of experimental medicine, 208(1), 103-114 (2011-01-12)
Cognate antigen recognition by CD4(+) T cells is thought to contribute to the tissue specificity of various autoimmune diseases, particularly those associated with class II MHC alleles. However, we show that localized class II MHC-dependent arthritis in F759 mice depends
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU095461-20UG | 04061828599523 |
| EHU095461-50UG | 04061828364978 |