Sign In to View Organizational & Contract Pricing.
Select a Size
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GTGGCCACCATGAAGACTTTGCTTAGAACTTGGTCAGAATTATATAGAGCATTTGCTCGTTGTGCTGCTTTGGTGGCAACAGCAGAAGAGAACTTGTGCTGTGAGGAACTTTCTTCCAAGATAATGTCCAGTTTGGAAGATGAAGGCTTTTCTAATTTGTTGTTCGTGGATAGAATTATTTATATTATTACTGTAATGGTTGATTGCATTGACTTCTCACCATATAATATTAAATATCAGCCCAAAGTTAAATCACCACAGAGACCTTCAGATTGGTCCAAAAAGAAGAATGAGCCCCTAGGGAAA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Quality Level
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Sylvie M Noordermeer et al.
Nature, 560(7716), 117-121 (2018-07-20)
53BP1 is a chromatin-binding protein that regulates the repair of DNA double-strand breaks by suppressing the nucleolytic resection of DNA termini1,2. This function of 53BP1 requires interactions with PTIP3 and RIF14-9, the latter of which recruits REV7 (also known as
Shin-Ichiro Hiraga et al.
EMBO reports, 18(3), 403-419 (2017-01-13)
The human RIF1 protein controls DNA replication, but the molecular mechanism is largely unknown. Here, we demonstrate that human RIF1 negatively regulates DNA replication by forming a complex with protein phosphatase 1 (PP1) that limits phosphorylation-mediated activation of the MCM
Satish Sati et al.
Molecular cell, 78(3), 522-538 (2020-03-30)
To understand the role of the extensive senescence-associated 3D genome reorganization, we generated genome-wide chromatin interaction maps, epigenome, replication-timing, whole-genome bisulfite sequencing, and gene expression profiles from cells entering replicative senescence (RS) or upon oncogene-induced senescence (OIS). We identify senescence-associated heterochromatin
Osama M Ahmed et al.
Cell reports, 27(9), 2527-2536 (2019-05-30)
Genetically wired neural mechanisms inhibit mating between species because even naive animals rarely mate with other species. These mechanisms can evolve through changes in expression or function of key genes in sensory pathways or central circuits. Gr32a is a gustatory
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service