Skip to Content
Merck
CN

EHU095951

Sigma-Aldrich

MISSION® esiRNA

targeting human PXN (1)

Sign Into View Organizational & Contract Pricing

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGACAACAGGCCCTGAGAAGCTAAGCGATTTGCCCTGTGGCATGGATGGTAGAGAGGGGAGCTGGCACTTGAACTCAGGTCTGGCTCGACCTCAGAATGAGTGATCTTGTGTCTCTGTGCCCCAGGACTGCATCCTCTCACCAATACTTCACCAGCCTAGGGATCTGTGCTCCCAAGAGCCTGTTGACATTGTAAACCTGAATCCAATCCATAAACCAAAAGCCCAGGCTTAGAATCACATTGTGGTGGAGCGGGTGTTTGGTGGAGTCCCTGATTCAAAATGTTTGACAAGGAAGCCTGACC

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PXN(5829), PXN(5829)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Panfeng Fu et al.
Pulmonary circulation, 5(4), 619-630 (2015-12-24)
Paxillin is a multifunctional and multidomain focal adhesion adaptor protein. It serves as an important scaffolding protein at focal adhesions by recruiting and binding to structural and signaling molecules. Paxillin tyrosine phosphorylation at Y31 and Y118 is important for paxillin
Wen-Chung Tsai et al.
Journal of orthopaedic research : official publication of the Orthopaedic Research Society, 35(11), 2506-2512 (2017-02-25)
Platelet rich plasma (PRP) contains various cytokines and growth factors which may be beneficial to the healing process of injured muscle. The aim of this study was to investigate the effect and molecular mechanism of PRP on migration of skeletal
Tobias Pasqualon et al.
Oncotarget, 6(31), 31295-31312 (2015-09-18)
Syndecan-1 is a surface expressed heparan sulphate proteoglycan, which is upregulated by several tumor types and involved in tumor cell migration and metastasis. Syndecan-1 is shed from the cell surface and the remaining transmembrane fragment undergoes intramembrane proteolysis by γ-secretase.
Ludiane Gauthier et al.
Cancer research, 77(24), 7072-7082 (2017-10-13)
CD8
Yi-Ping Shih et al.
Cancer letters, 398, 46-51 (2017-04-15)
DLC1 is a RhoGAP-containing tumor suppressor that inhibits angiogenesis by repressing VEGF production in epithelial cells. Here we report the roles of DLC1 in endothelial cells. Silencing of DLC1 (siDLC1) enhances cell migration but reduces tube formation activities of human

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service