Skip to Content
Merck
CN

EHU096141

MISSION® esiRNA

targeting human MAX

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human MAX

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GACAGATTCGCAGCACAGAGTCGCTGGCATGTTTCACTCCTGCTTCTCTCAGCCAGCTGTTTAAGCCTGCGGCGCCAGCCTCACGGAGGGCCGTGTGACACTCTCGTGGTATGTATGGGAGATGGCAGCAGTGAAGCAGCAGCCACCAGGGAGTGGCCATTTGGGGTTGGGACAGGGAGGGTGTTTTGGGTGGCATAGAGGTTTTGTATTGAGGGCCAGTGATGATGTTTTGATATTTATTTCCTGCTACTTAAATTTGAATCTGAGTGAATTGTACCTATTTCTGATGATGTCGGTCTTGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... MAX(4149), MAX(4149)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Olivier Godfroy et al.
The Plant cell, 29(12), 3102-3122 (2017-12-07)
Brown algae are one of the most developmentally complex groups within the eukaryotes. As in many land plants and animals, their main body axis is established early in development, when the initial cell gives rise to two daughter cells that
Mi-Ok Lee et al.
Biochemical and biophysical research communications, 520(2), 406-412 (2019-10-15)
Selenium (Se) plays a vital role in reactive oxygen species (ROS) homeostasis and redox regulation in intracellular signaling via selenocysteine (Sec), known as the 21st proteinogenic amino acid, but its specific biological functions in development and disease remain undiscovered. In
Tsz-Lun Yeung et al.
Oncotarget, 8(10), 16951-16963 (2017-02-16)
Transcription factors are master switches for various biochemical pathways. However, transcription factors involved in the pathogenesis of ovarian cancer have yet to be explored thoroughly. Therefore, in the present study, we assessed the prognostic value of the transcription factor E74-like
Kristina Pravoverov et al.
Cellular and molecular neurobiology, 39(7), 917-934 (2019-05-20)
Neuronal connectivity is dependent on size and shape of the dendritic arbor. However, mechanisms controlling dendritic arborization, especially in the peripheral nervous system, are not completely understood. Previous studies have shown that bone morphogenetic proteins (BMPs) are important initiators of
Antonella Caivano et al.
Oncotarget, 8(21), 34298-34309 (2017-04-19)
This study investigates the role of ephrin receptor A3 (EphA3) in the angiogenesis of Multiple Myeloma (MM) and the effects of a selective target of EphA3 by a specific monoclonal antibody on primary bone marrow endothelial cells (ECs) of MM

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service