Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCAGCACTTTGACTGCTCTGGAGTAGGGTTGTACAATTTCAAGGAATGTTTGGATTTCCTGCATCTTGTGGATTACTCCTTAGATACCGCATAGATTGCAATATAATGCTGCATGTTCAAGATGAACAGTAGCTCCTAGTAATCATAAAATCCACTCTTTGCACAGTTTGATCTTTACTGAAATATGTTGCCAAAATTTATTTTTGTTGTTGTAGCTCTGGATTTTGTTTTGTTTTGTTTTTTAAGGAAACGATTGACAATACCCTTTAACATCTGTGACTACTAAGGAAACCTATTTCTTTCATAGAGAGAAAAATCTCCAATGCTTTTGAAGACA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... ATXN1(6310)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
A-Ram Kang et al.
Oncotarget, 8(11), 18248-18259 (2017-02-18)
The mutant form of the protein ataxin-1 (ATXN1) causes the neurodegenerative disease spinocerebellar ataxia type-1. Recently, ATXN1 was reported to enhance E-cadherin expression in the breast cancer cell line MCF-7, suggesting a potential association between ATXN1 and cancer development. In
Larissa Nitschke et al.
Genes & development, 34(17-18), 1147-1160 (2020-08-09)
Identifying modifiers of dosage-sensitive genes involved in neurodegenerative disorders is imperative to discover novel genetic risk factors and potential therapeutic entry points. In this study, we focus on Ataxin-1 (ATXN1), a dosage-sensitive gene involved in the neurodegenerative disease spinocerebellar ataxia
Yuka Sugihara et al.
PloS one, 14(5), e0217394-e0217394 (2019-05-29)
Recently, we showed that imidazole dipeptide such as carnosine contained abundantly in chicken breast meat improves brain function in a double-blind randomized controlled trial. However, the underlying molecular mechanisms remain unknown. Here, we investigated whether carnosine activates intestinal epithelial cells
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU096281-20UG | 04061831356670 |
| EHU096281-50UG | 04061828352838 |