Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GTGAATCATCTGGGGCACTTCTACCTTGTCCAGCTCCTCCAGGATGTTTTGTGCCGCTCAGCTCCTGCCCGTGTCATTGTGGTCTCCTCAGAGTCCCATCGATTTACAGATATTAACGACTCCTTGGGAAAACTGGACTTCAGTCGCCTCTCTCCAACAAAAAACGACTATTGGGCGATGCTGGCTTATAACAGGTCCAAGCTCTGCAACATCCTCTTCTCCAACGAGCTGCACCGTCGCCTCTCCCCACGCGGGGTCACGTCGAACGCAGTGCATCCTGGAAATATGATGTACTCCAACATTCATCGCAGCTGGTGGGTGTACACACTGC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... WWOX(51741)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Jia Wen et al.
Oncotarget, 8(37), 60917-60932 (2017-10-06)
WWOX (WW domain-containing oxidoreductase) is known to be an important tumor suppressor in cancer. In this study, we used samples from 201 osteosarcoma patients to investigate the effects of WWOX on angiogenesis and invasion. WWOX levels were negatively correlated with
Y Xu et al.
European review for medical and pharmacological sciences, 24(3), 1041-1053 (2020-02-26)
Ovarian cancer is a highly invasive type of cancer. A previous study demonstrated that E-cadherin expression was upregulated in a human ovarian cancer cell line with a high expression of WW domain-containing oxidoreductase (WWOX), which is a tumor suppressor. Also
Yuhang Su et al.
Journal of cellular biochemistry, 115(11), 1900-1907 (2014-06-10)
Glioma is a common primary intracranial carcinoma with high incidence, recurrence, and motility. Single minded homolog 2-short form (SIM2-s), a member of basic helix-loop-helix (bHLH) family, is reported to be expressed in glioma and might play a role in the
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU096521-20UG | 04061831356717 |
| EHU096521-50UG | 04061828353057 |