Skip to Content
Merck
CN

EHU097551

MISSION® esiRNA

targeting human TET3 (1)

Sign In to View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCTTTGGTTGTTCCTGGAGCATGTACTTCAACGGCTGCAAGTATGCTCGGAGCAAGACACCTCGCAAGTTCCGCCTCGCAGGGGACAATCCCAAAGAGGAAGAAGTGCTCCGGAAGAGTTTCCAGGACCTGGCCACCGAAGTCGCTCCCCTGTACAAGCGACTGGCCCCTCAGGCCTATCAGAACCAGGTGACCAACGAGGAAATAGCGATTGACTGCCGTCTGGGGCTGAAGGAAGGACGGCCCTTCGCGGGGGTCACGGCCTGCATGGACTTCTGTGCCCACGCCCACAAGGACCAGCATAACCTCTACAATGGGTGCACC

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Liang-Qi Cao et al.
Molecular cancer, 18(1), 148-148 (2019-10-28)
As an important means of communication, exosomes play an important role in the development of hepatocellular carcinoma (HCC). Bioinformatics analysis, dual-luciferase reporter assays, methylation-specific quantitative PCR, and ChIP-PCR analysis were used to gain insight into the underlying mechanism of miR-21
Jie Li et al.
Journal of Cancer, 12(1), 207-216 (2021-01-05)
Background: Berberine, as an alkaloid, has a significant antitumor effect, but its mechanism in tumor metabolism, especially the Warburg effect has not been elucidated. Objectives: To study the molecular mechanism of berberine regulating the Warburg effect in ovarian cancer cells.
Suhas S Kharat et al.
Science signaling, 13(645) (2020-08-21)
Synthetic lethality between poly(ADP-ribose) polymerase (PARP) inhibition and BRCA deficiency is exploited to treat breast and ovarian tumors. However, resistance to PARP inhibitors (PARPis) is common. To identify potential resistance mechanisms, we performed a genome-wide RNAi screen in BRCA2-deficient mouse

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service