Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TTTCCAACGACACAGTCAGCCCCCGAGCCTCCGCATCGTACTATGAACAGTATCACTCACTAAATGAAATCTATTCTTGGATAGAATTTATAACTGAGAGGCATCCTGATATGCTTACAAAAATCCACATTGGATCCTCATTTGAGAAGTACCCACTCTATGTTTTAAAGGTTTCTGGAAAAGAACAAGCAGCCAAAAATGCCATATGGATTGACTGTGGAATCCATGCCAGAGAATGGATCTCTCCTGCTTTCTGCTTGTGGTTCATAGGCCAT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... CPB2(1361)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Chao Yu et al.
Molecular medicine reports, 16(3), 3469-3474 (2017-08-03)
Human thrombin activatable fibrinolysis inhibitor (TAFI), also known as carboxypeptidase B2 (CPB2), is a procarboxypeptidase enzyme. The purpose of the present study was to observe the expression of TAFI in breast cancer (BC) and breast cancer cell (BCC) lines and
Shudi Yang et al.
Molecular pharmaceutics, 15(1), 314-325 (2017-12-19)
In this article, a novel graft polymeric micelle with targeting function ground on aptamer AS1411 was synthesized. The micelle was based on chitosan-ss-polyethylenimine-urocanic acid (CPU) with dual pH/redox sensitivity and targeting effects. This micelle was produced for codelivering Toll-like receptor
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU097601-20UG | 04061828588572 |
| EHU097601-50UG | 04061828354122 |
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service