Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CGTGATGCCAGAGAAGATGAGCTCCGAGAAGGTGGACGTGCTGCGGGCACTGGGGGCTGAGATTGTGAGGACGCCCACCAATGCCAGGTTCGACTCCCCGGAGTCACACGTGGGGGTGGCCTGGCGGCTGAAGAACGAAATCCCCAATTCTCACATCCTAGACCAGTACCGCAACGCCAGCAACCCCCTGGCTCACTACGACACCACCGCTGATGAGATCCTGCAGCAGTGTGATGGGAAGCTGGAC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... CBS(102724560), CBS(875)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Liam J O'Connor et al.
ACS central science, 3(1), 20-30 (2017-02-06)
Azide-containing compounds have broad utility in organic synthesis and chemical biology. Their use as powerful tools for the labeling of biological systems
Xingji You et al.
Reproduction (Cambridge, England), 153(5), 535-543 (2017-02-12)
Recent evidence suggests that uterine activation for labor is associated with inflammation within uterine tissues. Hydrogen sulfide (H
Nozomu Takahashi et al.
Nucleic acids research, 45(1), 435-445 (2016-08-29)
The 2-methylthio (ms
Qian-Rong Qi et al.
Endocrinology, 161(11) (2020-09-29)
Angiogenesis is a physiological process for endometrial regeneration in the menstrual cycle and remodeling during pregnancy. Endogenous hydrogen sulfide (H2S), produced by cystathionine-β synthase (CBS) and cystathionine-γ lyase (CSE), is a potent proangiogenic factor; yet, whether the H2S system is
Amanda R Jensen et al.
Shock (Augusta, Ga.), 53(6), 737-743 (2019-07-28)
Hydrogen sulfide (H2S) has many beneficial biological properties, including the ability to promote vasodilation. It has been shown to be released from stem cells and increased by hypoxia. Therefore, H2S may be an important paracrine factor in stem cell-mediated intestinal
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU099041-50UG | 04061828365715 |
| EHU099041-20UG | 04061828589821 |
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service