Sign In to View Organizational & Contract Pricing.
Select a Size
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CTCCTCGCAGGTACAAAAGCAGCTGGGGCCACCACAGATGTCAGAGTTGCATCACCTGTGCTGTCATCAATCGTGTTCAGAAGGTCAACTGCACAGCTACCTCTAATGCTGTCTGTGGGGACTGTTTGCCCAGGTTCTACCGAAAGACACGCATTGGAGGCCTGCAGGACCAAGAGTGCATCCCGTGCACGAAGCAGACCCCCACCTCTGAGGTTCAATGTGCCTTCCAGT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Quality Level
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Mi Hee Kwack et al.
Biochemical and biophysical research communications, 529(3), 766-772 (2020-08-02)
Androgenetic alopecia (AGA) is a common genetic disorder, and a X-chromosomal locus that contains the androgen receptor (AR) and ectodysplasin A2 receptor (EDA2R) genes represents a major susceptibility locus for AGA. In our previous study, we reported that ectodysplasin-A2 (EDA-A2)
Margherita Sisto et al.
Clinical and experimental medicine, 17(1), 111-119 (2015-12-15)
Despite recent advancements in the knowledge of the etiology and pathogenic mechanisms, treatment of the autoimmune disease Sjögren's syndrome (SS) remains mostly empiric and symptom-based, indicating the need for novel therapeutic approaches. Ectodysplasin-A2 (EDA-A2) is a recently isolated member of
Xiqian Lan et al.
Biochimie, 174, 74-83 (2020-04-19)
EDA2R is a member of the large family of tumor necrosis factor receptor (TNFR). Previous studies suggested that EDA2R expression might be increased in the kidneys of diabetic mice. However, its mRNA and protein expression in kidneys were not analyzed;
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service