Sign In to View Organizational & Contract Pricing.
Select a Size
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ACGATGCATGCCATATACGAAAGGAAAAAGGGCAGGGGGTTCCCCCAAACTTTCGAAGTAGGCCCTGGCAGGCAGCTGGGAGCCATCCTGAAGAGCTGTAACATGCAGGCCTGGAAGTCCTACAGCGCCGTGGATGTGCTGCAGACCCTCGAACATGTGGACCTGGACCCTCAGGAGCCCCCGAGATGACTGCAGGGGGCTCAAATGCGATGACCCCCTCTGTCCTCCTGAGGAGAGGCTGTAGGCTGTGCCTGTCGCCCCCTACCTTCCTAATGGCTCCTCCTCTGAGGAGTGAAAGGGATTTGTTTGCAACG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Quality Level
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
The adaptor protein ARA55 and the nuclear kinase HIPK1 assist c-Myb in recruiting p300 to chromatin.
Mads Bengtsen et al.
Biochimica et biophysica acta, 1860(7), 751-760 (2017-05-13)
LIM-domain proteins, containing multiple cysteine-rich zinc finger-like motifs, have been shown to play diverse roles in several cellular processes. A common theme is that they mediate important protein-protein interactions that are key to their function. Androgen receptor-associated protein 55 (ARA55)
Chunxiao Yan et al.
International journal of clinical and experimental pathology, 8(3), 2710-2718 (2015-06-06)
This study was designed to investigate the role of MCT1 in the development of cisplatin-resistant ovarian cancer and its possible relationship with Fas. We found the expression of MCT1 was obviously increased both in cisplatin-resistant ovarian cancer tissue and A2780/CP
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service