Skip to Content
Merck
CN

EHU099841

Sigma-Aldrich

MISSION® esiRNA

targeting human MCAT

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACGATGCATGCCATATACGAAAGGAAAAAGGGCAGGGGGTTCCCCCAAACTTTCGAAGTAGGCCCTGGCAGGCAGCTGGGAGCCATCCTGAAGAGCTGTAACATGCAGGCCTGGAAGTCCTACAGCGCCGTGGATGTGCTGCAGACCCTCGAACATGTGGACCTGGACCCTCAGGAGCCCCCGAGATGACTGCAGGGGGCTCAAATGCGATGACCCCCTCTGTCCTCCTGAGGAGAGGCTGTAGGCTGTGCCTGTCGCCCCCTACCTTCCTAATGGCTCCTCCTCTGAGGAGTGAAAGGGATTTGTTTGCAACG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Mads Bengtsen et al.
Biochimica et biophysica acta, 1860(7), 751-760 (2017-05-13)
LIM-domain proteins, containing multiple cysteine-rich zinc finger-like motifs, have been shown to play diverse roles in several cellular processes. A common theme is that they mediate important protein-protein interactions that are key to their function. Androgen receptor-associated protein 55 (ARA55)
Chunxiao Yan et al.
International journal of clinical and experimental pathology, 8(3), 2710-2718 (2015-06-06)
This study was designed to investigate the role of MCT1 in the development of cisplatin-resistant ovarian cancer and its possible relationship with Fas. We found the expression of MCT1 was obviously increased both in cisplatin-resistant ovarian cancer tissue and A2780/CP

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service