Merck
CN
All Photos(1)

Documents

Safety Information

EHU099881

Sigma-Aldrich

MISSION® esiRNA

targeting human FN1

Sign Into View Organizational & Contract Pricing
All Photos(1)
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACACCTTCGGGGGAAATAATTCCTGTGAATATTCTTTTTCAATTCAGCAAACATTTGAAAATCTATGATGTGCAAGTCTAATTGTTGATTTCAGTACAAGATTTTCTAAATCAGTTGCTACAAAAACTGATTGGTTTTTGTCACTTCATCTCTTCACTAATGGAGATAGCTTTACACTTTCTGCTTTAATAGATTTAAGTGGACCCCAATATTTATTAAAATTGCTAGTTTACCGTTCAGAAGTATAATAGAAATAATCTTTAGTTGCTCTTTTCTAACCATTGTAATTCTTCCCTTCTTCCCTCCACCTTTC

Ensembl | human accession no.

ENSG00000115414

NCBI accession no.

NM_212474

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... FN1(2335) , FN1(2335)

Related Categories

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Documents related to the products that you have purchased in the past have been gathered in the Document Library for your convenience.

Visit the Document Library

Difficulty Finding Your Product Or Lot/Batch Number?

Product numbers are combined with Pack Sizes/Quantity when displayed on the website (example: T1503-25G). Please make sure you enter ONLY the product number in the Product Number field (example: T1503).

Example:

T1503
Product Number
-
25G
Pack Size/Quantity

Additional examples:

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

enter as 1.000309185)

Having trouble? Feel free to contact Technical Service for assistance.

Lot and Batch Numbers can be found on a product's label following the words 'Lot' or 'Batch'.

Aldrich Products

  • For a lot number such as TO09019TO, enter it as 09019TO (without the first two letters 'TO').

  • For a lot number with a filling-code such as 05427ES-021, enter it as 05427ES (without the filling-code '-021').

  • For a lot number with a filling-code such as STBB0728K9, enter it as STBB0728 without the filling-code 'K9'.

Not Finding What You Are Looking For?

In some cases, a COA may not be available online. If your search was unable to find the COA you can request one.

Request COA

Seth P Zimmerman et al.
Journal of cell science, 130(18), 2971-2983 (2017-07-30)
Rho GTPase family members are known regulators of directed migration and therefore play key roles in processes including development, the immune response and cancer metastasis. However, their individual contributions to these processes are complex. Here, we modify the activity of
Ulrich Blache et al.
EMBO reports, 19(8) (2018-07-04)
The fate of mesenchymal stem cells (MSCs) in the perivascular niche, as well as factors controlling their fate, is poorly understood. Here, we study MSCs in the perivascular microenvironment of endothelial capillaries by modifying a synthetic 3D biomimetic poly(ethylene glycol)
Najla El-Hachem et al.
Cell death and differentiation, 25(11), 2010-2022 (2018-03-09)
HACE1 is an E3 ubiquitin ligase described as a tumour suppressor because HACE1-knockout mice develop multi-organ, late-onset cancers and because HACE1 expression is lost in several neoplasms, such as Wilms' tumours and colorectal cancer. However, a search of public databases
Wenzhong Yi et al.
Oncology reports, 36(6), 3145-3153 (2016-10-18)
Fibronectin is a glycoprotein of the extracellular matrix, and regulates the processes of self-renewal and cell cycle progression. This study aimed to investigate fibronectin expression in colorectal cancer (CRC) and elucidate the effects of fibronectin on CRC by using a
Changgeng Xu et al.
Molecular medicine reports, 13(1), 901-908 (2015-12-10)
Lefty is a member of the transforming growth factor (TGF) β superfamily, which is implicated in left‑right patterning during embryogenesis. Previous studies revealed that lefty attenuates the epithelial‑mesenchymal transition in tubular epithelial cells. In the present study, the protective effect
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service