Sign In to View Organizational & Contract Pricing.
Select a Size
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TTTGAAGGAGCTGAGCGAGTCGGTCCAGCAACAGTCCACCCCTGTTCCTCTCATCTCTCCCAAGCGCCAGATTCGTAGCAGGTTCCAGCTGAATCTTGACAAGACCATAGAGAGTTGCAAAGCACAATTAGGCATAAATGAAATCTCGGAAGATGTCTATACGGCCGTAGAGCACAGCGATTCGGAGGATTCTGAGAAGTCAGATAGTAGCGATAGTGAGTATATCAGTGATGATGAGCAGAAGTCTAAGAACGAGCCAGAAGACACAGAGGACAAAGAAGGTTGTCAGATGGACAAAGAGCCATCTGC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Quality Level
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Shravanti Mukherjee et al.
Cell death & disease, 11(12), 1073-1073 (2020-12-17)
The major challenge in chemotherapy lies in the gain of therapeutic resistance properties of cancer cells. The relatively small fraction of chemo-resistant cancer cells outgrows and are responsible for tumor relapse, with acquired invasiveness and stemness. We demonstrate that zinc-finger
Moitri Basu et al.
Biochimica et biophysica acta, 1860(4), 450-459 (2017-02-25)
All trans retinoic acid (ATRA), an active vitamin-A derivative, has been shown to regulate gene expression program and thus imparts anti-proliferative activity to cancer cells. Previously, we identified a dual histone reader ZMYND8 (zinc finger MYND (Myeloid, Nervy and DEAF-1)-type
Moitri Basu et al.
The Biochemical journal, 474(11), 1919-1934 (2017-04-23)
Enhanced migratory potential and invasiveness of cancer cells contribute crucially to cancer progression. These phenotypes are achieved by precise alteration of invasion-associated genes through local epigenetic modifications which are recognized by a class of proteins termed a chromatin reader. ZMYND8
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service