Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGCACCCAGCCTAGAATCTTGTATAATATGTAATTGTAGGGAAACTGCTCTCATAGGAAAGTTTTCTGCTTTTTAAATACAAAAATACATAAAAATACATAAAATCTGATGATGAATATAAAAAAGTAACCAACCTCATTGGAACAAGTATTAACATTTTGGAATATGTTTTATTAGTTTTGTGATGTACTGTTTTACAATTTTTACCATTTTTTTCAGTAATTACTGTAAAATGGTATTATTGGAATGAAACTATATTTCCTCATGTGCTGATTTGTCTTATTTTTTTCATACTTTCCCACTGGTGC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... CLEC7A(64581)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Esther Weiss et al.
Frontiers in cellular and infection microbiology, 8, 288-288 (2018-09-05)
Invasive aspergillosis (IA) is an infectious disease caused by the fungal pathogen Aspergillus fumigatus that mainly affects immunocompromised hosts. To investigate immune cell cross-talk during infection with A. fumigatus, we co-cultured natural killer (NK) cells and dendritic cells (DC) after
Cheng-Ye Che et al.
International journal of ophthalmology, 11(6), 905-909 (2018-07-07)
To investigate the regulation of lipoxygenase (LOX)-1 and Dectin-1 on interleukin-10 (IL-10) production in mice with Aspergillus fumigatus (A. fumigatus) keratitis. The corneas of C57BL/6 mice were pretreated with LOX-1 inhibitor Poly(I) or Dectin-1 siRNA separately before the infection of
Nobuaki Fujiwara et al.
Cancer gene therapy, 26(1-2), 32-40 (2018-07-05)
Antisense oligonucleotides (AS-ODNs) hybridize with specific mRNAs, resulting in interference with the splicing mechanism or the regulation of protein translation. We previously demonstrated that the β-glucan schizophyllan (SPG) can form a complex with AS-ODNs with attached dA40 (AS-ODNs/SPG), and this
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU100561-20UG | 04061828591213 |
| EHU100561-50UG | 04061828367177 |