EHU101361
MISSION® esiRNA
targeting human MAP3K3
Sign Into View Organizational & Contract Pricing
Select a Size
About This Item
UNSPSC Code:
41105324
NACRES:
NA.51
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AAGGAGGTGAGTGCTCTGGAGTGCGAGATCCAGTTGCTAAAGAACTTGCAGCATGAGCGCATCGTGCAGTACTATGGCTGTCTGCGGGACCGCGCTGAGAAGACCCTGACCATCTTCATGGAGTACATGCCAGGGGGCTCGGTGAAAGACCAGTTGAAGGCTTACGGTGCTCTGACAGAGAGCGTGACCCGAAAGTACACGCGGCAGATCCTGGAGGGCATGTCCTACCTGCACAGCAACATGATTGTTCACCGGGACAT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... MAP3K3(4215), MAP3K3(4215)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point(F)
Not applicable
Flash Point(C)
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Yue Zheng et al.
FEBS letters, 591(15), 2290-2298 (2017-06-24)
Lineage-negative bone marrow cells (lin-BMCs) have reparative potential for overcoming endothelial dysfunction and reducing cardiovascular risk. Here, we found that miR-188 is upregulated and mitogen-activated protein kinase kinase kinase 3 (MAP3K3) is downregulated in aged lin-BMCs, whereas their expression is reversed
Longping Yao et al.
Journal of neuroinflammation, 15(1), 13-13 (2018-01-14)
Parkinson's disease (PD) is the most prevalent neurodegenerative disorder that is characterised by selective loss of midbrain dopaminergic (DA) neurons. Chronic inflammation of the central nervous system is mediated by microglial cells and plays a critical role in the pathological
Ganesh Umapathy et al.
Science signaling, 7(349), ra102-ra102 (2014-10-30)
Anaplastic lymphoma kinase (ALK) is an important molecular target in neuroblastoma. Although tyrosine kinase inhibitors abrogating ALK activity are currently in clinical use for the treatment of ALK-positive (ALK(+)) disease, monotherapy with ALK tyrosine kinase inhibitors may not be an
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service