Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TTACGTTCCTCCCAAAGGTGATAAGAAGGGGAAGAAAAAGGACCCCAATGCTCCTAAAAGGCCACCATCTGCCTTCTTCCTGTTTTGCTCTGAACATCGCCCAAAGATCAAAAGTGAACACCCTGGCCTATCCATTGGGGATACTGCAAAGAAATTGGGTGAAATGTGGTCTGAGCAGTCAGCCAAAGATAAACAACCATATGAACAGAAAGCAGCTAAGCTAAAGGAGAAATATGAAAAGGATATTGCTGCATATCGTGCCAAGGGCAAAAGTGAAGCAGGAAAGAAGGGCCCTGGCAGGCCAACAGGCTCAAAGAAGAAGAACGAACCAGAAGATGAGGAGGAGGAGGAGGAAGAAGAAGATGAAGATGAGGAGGAAGAGGATGAAGATGAAGAATAAATGGCTATCCTTTAATGATGCGTGTGGAATGTGT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... HMGB2(3148)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Hongjuan Li et al.
American journal of cancer research, 8(5), 835-851 (2018-06-12)
Ovarian carcinoma is a fatal malignancy in gynecological malignancies, and the prognosis still remains poor due to the lack of effective therapeutic targets. This study demonstrated that centromere protein U (CENPU) was up-regulated in ovarian cancer. The ectopic expression of
Deokcheol Lee et al.
Scientific reports, 8(1), 9601-9601 (2018-06-27)
Although various surgical procedures have been developed for chronic rotator cuff tear repair, the re-tear rate remains high with severe fat infiltration. However, little is known about the molecular regulation of this process. Mesenchymal stem cells (MSCs) in the intra-muscular
Cuiping Zhang et al.
Haematologica, 105(3), 573-584 (2019-06-07)
Hematopoietic stem cells provide life-long production of blood cells and undergo self-renewal division in order to sustain the stem cell pool. Homeostatic maintenance of hematopoietic stem cell pool and blood cell production is vital for the organism to survive. We
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU105871-20UG | 04061831357547 |
| EHU105871-50UG | 04061828376568 |