Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CGCACCAAGTTTGAGACAGAGCAGGCCCTGCGCCTGAGTGTGGAGGCCGACATCAATGGCCTGCGCAGGGTGCTGGATGAGCTGACCCTGGCCAGAGCCGACCTGGAGATGCAGATTGAGAACCTCAAGGAGGAGCTGGCCTACCTGAAGAAGAACCACGAGGAGGAGATGAACGCCCTGCGAGGCCAGGTGGGTGGTGAGATCAATGTGGAGATGGACGCTGCCCCAGGCGTGGACCTGAGCCGCATCCTCAACGAGATGCGTGACCAGTATGAGAAGATGGCAGAGAAGAACCGCAAGGATGCCGAGGATTGGTTCTTCAGCAAGACAGAGGAACTGAACCGCGAGGTGGCCACCAACAGTGAGCTGGTGCAGAGTGGCAAGAGTGAGATCTCGGAGCTCCGGCGCACCATGCAGGCCTTGGAGATAGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... KRT17(3872)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Chun-Ying Xiao et al.
Chinese medical journal, 133(24), 2910-2918 (2020-11-26)
Psoriasis is a common chronic inflammatory skin disease with 2% to 3% prevalence worldwide and a heavy social-psychological burden for patients and their families. As the exact pathogenesis of psoriasis is still unknown, the current treatment is far from satisfactory.
Daisuke Ujiie et al.
Carcinogenesis, 41(5), 591-599 (2019-11-23)
Adjuvant chemotherapy is considered for patients with stage II colorectal cancer (CRC) characterized by poor prognostic clinicopathological features; however, current stratification algorithms remain inadequate for identifying high-risk patients. To develop prognostic assays, we conducted a step-wise screening and validation strategy
Hui Liu et al.
Gene, 563(1), 35-40 (2015-03-10)
Hereditary protein C deficiency (PCD) is an autosomal inherited disorder associated with high risk for venous thromboembolism (VTE). This study aimed to explore the functional consequences of two missense mutations, p.Asp297His and p.Val420Ile, responsible for type I/II PCD and recurrent
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU106111-20UG | 04061828613458 |
| EHU106111-50UG | 04061828376797 |