Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCGCTCTCGTTTCATTTTCTGCAGCGCGCCAGCAGGATGGCCCACAAGCAGATCTACTACTCGGACAAGTACTTCGACGAACACTACGAGTACCGGCATGTTATGTTACCCAGAGAACTTTCCAAACAAGTACCTAAAACTCATCTGATGTCTGAAGAGGAGTGGAGGAGACTTGGTGTCCAACAGAGTCTAGGCTGGGTTCATTACATGATTCATGAGCCAGAACCACATATTCTTCTCTTTAGACGACCTCTTCCAAAAGATCAACAAAAATGAAGTTTATCTGGGGATCGTCAAATCTTTTTCAAATTTAATGTATATGTGTATATAAGGTAGTATTCAGTGAATACTTGAGAAATGTACAAATCTTTCATCCATACCTGTGCATGAGCTGTATTCTTCACAGCAACAGAGCTCA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... CKS2(1164)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Jun Li et al.
Cancer communications (London, England), 38(1), 13-13 (2018-05-17)
Pancreatic duct adenocarcinoma (PDAC) remains a major health problem because conventional cancer treatments are relatively ineffective against it. Microarray studies have linked many genes to pancreatic cancer, but the available data have not been extensively mined for potential insights into
Min-Hao Yu et al.
American journal of cancer research, 5(9), 2708-2718 (2015-11-27)
Cyclin-dependent kinases regulatory subunit 2 (CKS2) is a cyclin-dependent kinase-interacting protein, which is essential for cell cycle regulation. Elevated expression of CKS2 has been demonstrated in multiple types of human malignancies. However, the clinical significance, oncogenic functions and related mechanisms
Yupeng Deng et al.
Oncology letters, 18(3), 2845-2852 (2019-08-28)
Cyclin-dependent kinase subunit (CKS) 2 is a member of the CKS family, which plays an important role in the regulation of meiosis and mitosis. Overexpression of CKS2 has been reported in several types of tumors. However, few studies have investigated
Global Trade Item Number
| SKU | GTIN |
|---|---|
| W273104-4KG-K | 04061838108043 |
| W273104-SAMPLE-K | 04061837516245 |
| V800015-500ML | 04061837552779 |
| 1601452-3X1.2ML | 04065273205657 |
| 293261-4L | 04061837289118 |
| 1061464000 | 04027269683962 |
| 360511-18L-CS | 04061837911071 |
| 360511-4L | 04061837566103 |
| 537713-4L | 04061832565910 |
| 1430203-3X1.2ML | 04061838734587 |
| 8208202500 | 04022536467344 |
| 8208206010 | 04022536467351 |
| MX1300-3 | 04061839430020 |
| MX1300-30 | 04061839430037 |