Skip to Content
Merck
CN

EHU108351

MISSION® esiRNA

targeting human DNAJB6

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGCAAGTAGCGGAGGCATATGAAGTGCTGTCGGATGCTAAGAAACGGGACATCTATGACAAATATGGCAAAGAAGGATTAAATGGTGGAGGAGGAGGTGGAAGTCATTTTGACAGTCCATTTGAATTTGGCTTCACATTCCGTAACCCAGATGATGTCTTCAGGGAATTTTTTGGTGGAAGGGACCCATTTTCATTTGACTTCTTTGAAGACCCTTTTGAGGACTTCTTTGGGAATCGAAGGGGTCCCCGAGGAAGCAGAAGCCGAGGGACGGGGTCGTTTTTCTCTGCGTTCAGTGGATTTCCGTCTTTTGGAAGTGGATTTTCTTCTTTTGATACAGGATTTACTTCATTTGGGTCACTAGGTCACGGGGGCCTCACTTCATTCTCTTCCACGTCATTTGGTGGTAGTGGCATG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yuli Lin et al.
BMC cancer, 14, 639-639 (2014-09-02)
The urokinase-type plasminogen activator receptor (uPAR) is an important regulator of ECM proteolysis, cell-ECM interactions and cell signaling. uPAR and heat shock proteins HSP70 and MRJ (DNAJB6) have been implicated in tumor growth and metastasis. We have reported recently that
Arun Thiruvalluvan et al.
Molecular cell, 78(2), 346-358 (2020-04-09)
CAG-repeat expansions in at least eight different genes cause neurodegeneration. The length of the extended polyglutamine stretches in the corresponding proteins is proportionally related to their aggregation propensity. Although these proteins are ubiquitously expressed, they predominantly cause toxicity to neurons.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service